Propagation of LacI regulog to Yersinia frederiksenii ATCC 33641

Reference regulog properties
Source regulog:	LacI - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Lactose utilization
Effector:	Allolactose
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Yersinia frederiksenii ATCC 33641
Orthologous TF(s)	YfreA_01000402
Regulated genes	1

Built upon 5 sites [see more]

Predicted regulatory interactions in *Yersinia frederiksenii ATCC 33641*
	Locus tag	Position	Score	Sequence
Position: -75 Score: 6.7 Sequence: AATTGTGAGCGCATAACATTT Locus tag: YfreA_01000403
	YfreA_01000403	-75	6.7	AATTGTGAGCGCATAACATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: lacZ
Ortholog function: Beta-galactosidase (EC 3.2.1.23)
Escherichia coli str. K-12 substr. MG1655	b0344	-38	7.4	AATTGTGAGCGGATAACAATT
Citrobacter koseri ATCC BAA-895	CKO_02825	-38	7	AATTGTGAGCGAATAACAAAC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_pKPN3p05871	-37	7.2	AAATGTGAGCGGATAACAATT
Enterobacter sp. 638	Ent638_0928	-29	6.3	AATTGTGAGCGCTTCGCAAAG
Erwinia carotovora subsp. atroseptica SCRI1043	ECA1490	-73	7.4	AATTGTGAGCGGATAACAATT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --