Propagation of MprA regulog to Yersinia frederiksenii ATCC 33641
Source regulog: | MprA - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | MarR |
Regulation mode: | repressor |
Biological process: | Multidrug resistance |
Effector: | 2,4-Dinitrophenol; Carbonyl cyanide m-chlorophenylhydrazone |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Yersinia frederiksenii ATCC 33641 |
Orthologous TF(s) | YfreA_01003828 |
Regulated genes | 2 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -130
Score: 5.6 Sequence: ATTCACGAATGTATGTACCATA
Locus tag: YfreA_01001852
|
||||
YfreA_01001852 | -130 | 5.6 | ATTCACGAATGTATGTACCATA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: acrA | ||||
Ortholog function: acriflavin resistance protein A | ||||
Escherichia coli str. K-12 substr. MG1655 | b0463 | -106 | 6.4 | ATTTGTGAATGTATGTACCATA |
Salmonella typhimurium LT2 | STM0476 | -106 | 5.9 | ATTTATGGATGTATGTACCATA |
Citrobacter koseri ATCC BAA-895 | CKO_02688 | -106 | 6.1 | ATTTGTGGATGTATGTACCATA |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_00444 | -107 | 6.4 | ATTTGTGAATGTATGTACCATA |
Enterobacter sp. 638 | Ent638_0943 | -107 | 5.7 | ATTTATGAATGTATGTAACATA |
Erwinia amylovora ATCC 49946 | EAM_1017 | -98 | 6.3 | ATTTGCGAATGTATGTACTATA |
Yersinia pestis KIM | y1050 | -109 | 5.6 | ATTCACGAATGTATGTACCATA |
Serratia proteamaculans 568 | Spro_1127 | -107 | 5.4 | ATTCGCGTATGTATGTACCATA |
Erwinia carotovora subsp. atroseptica SCRI1043 | ECA1170 | -107 | 4.5 | ATTCAAGTATGTATGTAACATA |
Proteus mirabilis HI4320 | PMI0132 | -117 | 3.8 | GATTTTGACTGAAGTTAATTTA |
-90 | 5.5 | ATTCATGTATGTTTGTACTATA | ||
-58 | 3.7 | ATTCATCAACTTAATTATTTTT | ||
Photorhabdus luminescens subsp. laumondii TTO1 | plu3851 | -94 | 4.8 | ATTCACGTATGTTTGTATTATA |
Position: -80
Score: 6.3 Sequence: ATTAGTCACTATCGTTACTGTA
Locus tag: YfreA_01003828
|
||||
YfreA_01003828 | -80 | 6.3 | ATTAGTCACTATCGTTACTGTA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: mprA | ||||
Ortholog function: Transcriptional repressor mprA (EmrR protein) | ||||
Escherichia coli str. K-12 substr. MG1655 | b2684 | -51 | 6.9 | ATTTGTCACTGTCGTTACTATA |
Salmonella typhimurium LT2 | STM2813 | -51 | 6.9 | ATTTGTCACTGTCGTTACTATA |
Citrobacter koseri ATCC BAA-895 | CKO_04033 | -51 | 6.9 | ATTTGTCACTGTCGTTACTATA |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_03013 | -150 | 6.2 | ATTTGTCACAATAGTTATTATA |
Enterobacter sp. 638 | Ent638_3162 | -51 | 6.9 | ATTTGTCACTGTCGTTACTATA |
Erwinia amylovora ATCC 49946 | EAM_2603 | -51 | 5.2 | ATTAATCACCATCATTATTATA |
Yersinia pestis KIM | y0923 | -26 | 6.1 | ATTAGTAACTATCGTTACTGTA |
Serratia proteamaculans 568 | Spro_3741 | -50 | 6.1 | ATTAATCACTATCGTTACTATC |
Erwinia carotovora subsp. atroseptica SCRI1043 | ECA3511 | -53 | 5.4 | TTTAGTAACATTAGTTACTATG |
Edwardsiella tarda EIB202 | ETAE_2765 | -51 | 5.1 | ACTGATAACCAAAGTTACTATA |
Photorhabdus luminescens subsp. laumondii TTO1 | plu1277 | -51 | 4.1 | TTTGATAACAAAAGTTATCTTA |