Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of TrpR regulog to Yersinia pseudotuberculosis IP 32953

Reference regulog properties
Source regulog: TrpR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Tryptophan biosynthesis
Effector: Tryptophan
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Yersinia pseudotuberculosis IP 32953
Orthologous TF(s) YPTB0596
Regulated genes 2
Built upon 44 sites [see more]
Predicted regulatory interactions in Yersinia pseudotuberculosis IP 32953
Locus tag Position Score Sequence
Position: -48
Score: 6.1
Sequence: TGTACTAGTTAAATAGTACT
Locus tag: YPTB0596
YPTB0596 -48 6.1 TGTACTAGTTAAATAGTACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: trpR
Ortholog function: Trp operon repressor
Escherichia coli str. K-12 substr. MG1655 b4393 -66 5.3 CGTACTCTTTAGCGAGTACA
Salmonella typhimurium LT2 STM4583 -34 5.6 TGTACTCGTGTAACAGTACA
Citrobacter koseri ATCC BAA-895 CKO_03393 -97 6 CGTACTCGTTAAAGAGTACA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04848 -65 5.7 TGTACTCGTTGAAGAGTACA
Enterobacter sp. 638 Ent638_0554 3 5.5 TGTACTcGTcAAagAGTACA
Erwinia amylovora ATCC 49946 EAM_0634 -33 6.2 TGTACTAGTTAAATAGTATG
Yersinia pestis KIM y3726 -24 6.1 TGTACTAGTTAAATAGTACT
Serratia proteamaculans 568 Spro_0676 -30 6.2 TGTACTAGTTAAATAGTATG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3899 -30 6.2 CGTACTAGTTAAATAGTATG
Edwardsiella tarda EIB202 ETAE_0543 -44 5.6 TGTACTCGTTGAATAGTTCA
Proteus mirabilis HI4320 PMI3714 -39 5.2 TGTACTAGTTTATGAGTGTG
Photorhabdus luminescens subsp. laumondii TTO1 plu0557 -34 6.2 TGTACTAGTTAAATAGTATG
Position: -158
Score: 5
Sequence: TGTACCATTCAGCTAGTACA
Locus tag: YPTB1317
YPTB1317 -158 5 TGTACCATTCAGCTAGTACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mtr
Ortholog function: Tryptophan-specific transport protein
Yersinia pestis KIM y2900 -139 5 TGTACCATTCAGCTAGTACA
Serratia proteamaculans 568 Spro_3236 -58 5.3 TGTACCATTGAGCTAGTACA
Edwardsiella tarda EIB202 ETAE_2287 -48 4.8 CGTACCATTGCGCTAGTACA