Propagation of CueR regulog to Pectobacterium wasabiae WPP163

Reference regulog properties
Source regulog:	CueR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Pectobacterium wasabiae WPP163
Orthologous TF(s)	Pecwa_3218
Regulated genes	1

Built upon 30 sites [see more]

Predicted regulatory interactions in *Pectobacterium wasabiae WPP163*
	Locus tag	Position	Score	Sequence
Position: -103 Score: 5.9 Sequence: ACCTTCCCCTTGCCAGAAGGT Locus tag: Pecwa_3220
	Pecwa_3220	-103	5.9	ACCTTCCCCTTGCCAGAAGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: copA
Ortholog function: Copper-translocating P-type ATPase (EC 3.6.3.4)
Erwinia carotovora subsp. atroseptica SCRI1043	ECA1193	-103	5.8	ACCCTCCCCTTGCTAGAAGGT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --