Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of YiaJ regulog to Pectobacterium wasabiae WPP163

Reference regulog properties
Source regulog: YiaJ - Enterobacteriales
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor
Biological process: L-lyxose utilization
Effector: Ascorbate-6-phosphate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Pectobacterium wasabiae WPP163
Orthologous TF(s) Pecwa_3884
Regulated genes 2
Built upon 8 sites [see more]
Predicted regulatory interactions in Pectobacterium wasabiae WPP163
Locus tag Position Score Sequence
Position: -73
Score: 6.3
Sequence: ATTTGAAATGCAATTTCGCAT
Locus tag: Pecwa_3889
Pecwa_3889 -73 6.3 ATTTGAAATGCAATTTCGCAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yiaK
Ortholog function: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
Escherichia coli str. K-12 substr. MG1655 b3575 -70 6.4 ATTTGAAATCAAGTTTCGCAT
Salmonella typhimurium LT2 STM3668 -82 6 ATTTGGAACTAGATTTCGCAT
Citrobacter koseri ATCC BAA-895 CKO_05033 -72 6.5 ATTTGAAATCAGATTTCGCAT
Serratia proteamaculans 568 Spro_3933 -74 6.1 ATTTGAAATGCAATTCCGCAT