Propagation of BetI regulog to Escherichia coli E24377A
| Source regulog: | BetI - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Glycine betaine synthesis |
| Effector: | Choline |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Escherichia coli E24377A |
| Orthologous TF(s) | EcE24377A_0328 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -66
Score: 6.6 Sequence: TATATTGAACGTCCAATCAA
Locus tag: EcE24377A_0328
|
||||
| EcE24377A_0328 | -66 | 6.6 | TATATTGAACGTCCAATCAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: betI | ||||
| Ortholog function: transcriptional regulator of glycine betaine synthesis | ||||
| Escherichia coli str. K-12 substr. MG1655 | b0313 | -66 | 6.6 | TATATTGAACGTCCAATCAA |
| Citrobacter koseri ATCC BAA-895 | CKO_02582 | -48 | 6.6 | TATATTGAACGTCCAATCAA |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_00586 | -48 | 6.6 | TATATTGAACGTCCAATCAA |
| Erwinia amylovora ATCC 49946 | EAM_1685 | -66 | 6.9 | TTGATTGAACGTTCAATATA |
| Serratia proteamaculans 568 | Spro_1513 | -124 | 7 | TTTATTGAACGTTCAATCAA |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA1744 | -103 | 7 | TTTATTGAACGTTCAATCAA |
| Proteus mirabilis HI4320 | PMI1461 | -68 | 6.5 | TTGATTGAATGTTCAATTAA |