Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of PdhR regulog to Citrobacter rodentium ICC168

Reference regulog properties
Source regulog: PdhR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Pyruvate metabolism
Effector: Pyruvate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Citrobacter rodentium ICC168
Orthologous TF(s) ROD_01191
Regulated genes 3
Built upon 44 sites [see more]
Predicted regulatory interactions in Citrobacter rodentium ICC168
Locus tag Position Score Sequence
Position: -69
Score: 5.7
Sequence: AACAATGGTTTTACCAATTGG
Locus tag: ROD_25241
ROD_25241 -69 5.7 AACAATGGTTTTACCAATTGG
Supported by regulated orthologs from reference regulons
Ortholog gene name: yfiD
Ortholog function: stress-induced alternate pyruvate formate-lyase subunit
Salmonella typhimurium LT2 STM2646 -71 5.7 AACAATGGTTTTACCAATTGG
Citrobacter koseri ATCC BAA-895 CKO_00205 -70 5.7 AACAATGGTTTTACCAATTGG
Enterobacter sp. 638 Ent638_3064 -67 5.7 AACAATGGTTTTACCAATTGG
© 2009-2020 RegPrecise