Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of Zur regulog to Citrobacter rodentium ICC168

Reference regulog properties
Source regulog: Zur - Enterobacteriales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Citrobacter rodentium ICC168
Orthologous TF(s) ROD_37001
Regulated genes 3
Built upon 65 sites [see more]
Predicted regulatory interactions in Citrobacter rodentium ICC168
Locus tag Position Score Sequence
Position: -52
Score: 6.5
Sequence: TTTTTGTTATATTATAACATTTC
Locus tag: ROD_12351
ROD_12351 -52 6.5 TTTTTGTTATATTATAACATTTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: zinT
Ortholog function: zinc-binding protein
Escherichia coli str. K-12 substr. MG1655 b1973 -56 6.3 TATATGTTACAATATAACATTAC
Salmonella typhimurium LT2 STM1263 -54 6.2 GCAATGTTATAATATAACAATCA
Citrobacter koseri ATCC BAA-895 CKO_01827 -91 6.8 GTGATGTTATATTATAACATTCC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04244 -55 5.7 GATATGTTATATCGTAACAATTT
Enterobacter sp. 638 Ent638_1993 -53 6.1 GATATGTTATACTATAACATCCT
Proteus mirabilis HI4320 PMI3380 -38 6.5 ATATTGTTATATTATAACATTAC
Position: -52
Score: 6.7
Sequence: GGAATGTTATAATATCACATTTC
Locus tag: ROD_18981
ROD_18981 -52 6.7 GGAATGTTATAATATCACATTTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: znuA
Ortholog function: high-affinity zinc ABC transporter, substrate-binding protein
Escherichia coli str. K-12 substr. MG1655 b1857 -52 6.5 GAAATGTTATAATATCACACTTC
Salmonella typhimurium LT2 STM1891 -52 6.6 AGAATGTTATAATATCACATTTC
Citrobacter koseri ATCC BAA-895 CKO_01106 -37 6.6 AGAATGTTATAATATCACATTTC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02372 -100 6.3 TGAATGTTATAATATCACATCAC
Enterobacter sp. 638 Ent638_2426 -52 6.1 CGAATGTTATAATATCACATCCA
Erwinia amylovora ATCC 49946 EAM_2000 -52 5.9 CAAATGTTATAATATCACAAAAT
Yersinia pestis KIM y2249 -51 5.6 TGAATGTTATAATATTACGCTTT
Serratia proteamaculans 568 Spro_2773 -51 5.7 CGAATGTTATAATATCACGCCTC
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2484 -53 6.3 GTAATGTTATAATATAACAAACA
Edwardsiella tarda EIB202 ETAE_1443 -50 6.6 GGAATGTTATAATATAACGTTTC
Proteus mirabilis HI4320 PMI1152 -50 6.7 GAAACGTTATAATATAACATTTC
Photorhabdus luminescens subsp. laumondii TTO1 plu2115 -51 6.6 GAGATGTTATAATATAACAATTC
Position: -49
Score: 6.8
Sequence: GAAATGTGATATTATAACATTCC
Locus tag: ROD_18991
ROD_18991 -49 6.8 GAAATGTGATATTATAACATTCC
Supported by regulated orthologs from reference regulons
Ortholog gene name: znuC
Ortholog function: high-affinity zinc ABC transporter, ATP-binding protein
Escherichia coli str. K-12 substr. MG1655 b1858 -49 6.5 GAAGTGTGATATTATAACATTTC
Salmonella typhimurium LT2 STM1892.S -49 6.7 GAAATGTGATATTATAACATTCT
Citrobacter koseri ATCC BAA-895 CKO_01105 -49 6.7 GAAATGTGATATTATAACATTCT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02373 -49 6.4 GTGATGTGATATTATAACATTCA
Enterobacter sp. 638 Ent638_2427 -48 6.2 TGGATGTGATATTATAACATTCG
Erwinia amylovora ATCC 49946 EAM_2001 -48 6.1 ATTTTGTGATATTATAACATTTG
Yersinia pestis KIM y2250 -47 5.7 AAAGCGTAATATTATAACATTCA
Serratia proteamaculans 568 Spro_2774 -50 5.8 GAGGCGTGATATTATAACATTCG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2485 -46 6.4 TGTTTGTTATATTATAACATTAC
Edwardsiella tarda EIB202 ETAE_1442 -72 6.7 GAAACGTTATATTATAACATTCC
Proteus mirabilis HI4320 PMI1151 -47 6.7 GAAATGTTATATTATAACGTTTC
Photorhabdus luminescens subsp. laumondii TTO1 plu2114 -48 6.6 GAATTGTTATATTATAACATCTC