Propagation of RutR regulog to Citrobacter rodentium ICC168
Source regulog: | RutR - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Pyrimidine utilization |
Effector: | Uracil |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Citrobacter rodentium ICC168 |
Orthologous TF(s) | ROD_10661 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -293
Score: 6.1 Sequence: TTTTGACCAGATGGTCCACT
Locus tag: ROD_00351
|
||||
ROD_00351 | -293 | 6.1 | TTTTGACCAGATGGTCCACT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: carA | ||||
Ortholog function: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5) | ||||
Escherichia coli str. K-12 substr. MG1655 | b0032 | -294 | 6.5 | TTTTGACCATTTGGTCCACT |
Salmonella typhimurium LT2 | STM0066 | -294 | 6.5 | ATTTGACCATTTGGTCCACT |
Citrobacter koseri ATCC BAA-895 | CKO_03351 | -268 | 6.4 | TTTTGACCAAATGGTCCACT |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_00040 | -267 | 6.4 | TTTTGACCATCTGGTCCACT |
Enterobacter sp. 638 | Ent638_0591 | -294 | 5.8 | TTTTGACCATTTGGTCTGGT |
Erwinia amylovora ATCC 49946 | EAM_0660 | -297 | 6.2 | TTCTGACCATTTGGTCCACT |