Propagation of MarR regulog to Citrobacter rodentium ICC168

Reference regulog properties
Source regulog:	MarR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	MarR
Regulation mode:	repressor
Biological process:	Antibiotic resistance
Effector:	Salicylate; Tetracycline; Chloramphenicol
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Citrobacter rodentium ICC168
Orthologous TF(s)	ROD_15081
Regulated genes	1

Built upon 10 sites [see more]

Predicted regulatory interactions in *Citrobacter rodentium ICC168*
	Locus tag	Position	Score	Sequence
Position: -22 Score: 6.8 Sequence: ATTACTTGCCAGGGCAACCATT Locus tag: ROD_15081
	ROD_15081	-22	6.8	ATTACTTGCCAGGGCAACCATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: marR
Ortholog function: DNA-binding transcriptional repressor MarR
Citrobacter koseri ATCC BAA-895	CKO_01551	-57	6.7	TATATTTGCCTGGGCAATAGTA
		-22	6.7	ACTACTTGCCGGGGCAACCATT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --