Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of Zur regulog to Candidatus Blochmannia floridanus

Reference regulog properties
Source regulog: Zur - Enterobacteriales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Candidatus Blochmannia floridanus
Orthologous TF(s) Bfl026
Regulated genes 1
Built upon 65 sites [see more]
Predicted regulatory interactions in Candidatus Blochmannia floridanus
Locus tag Position Score Sequence
Position: -172
Score: 6.1
Sequence: AATATGTTATGTTATAACATTTA
Locus tag: Bfl040
Bfl040 -172 6.1 AATATGTTATGTTATAACATTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: znuC2
Ortholog function: putative zinc ABC transporter, ATP-binding protein
Citrobacter koseri ATCC BAA-895 CKO_04054 -141 6.1 TTATTGTTATGTTATAACATTTT
Citrobacter koseri ATCC BAA-895 CKO_00951 -45 5.7 CATTTGTTATGTTATAACGTTAC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03035 -108 6 TTATTGTTATGTTATAACATTAA
Enterobacter sp. 638 Ent638_3178 -140 5.9 TTAGTGTTATGTTATAACATTAT
Serratia proteamaculans 568 Spro_1121 -185 5.8 GTGATGTTATAATGTAACACTTA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3756 -123 6.5 GATATGTTATAATATAACAATTA