Propagation of Zur regulog to Candidatus Blochmannia floridanus
| Source regulog: | Zur - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Candidatus Blochmannia floridanus |
| Orthologous TF(s) | Bfl026 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -172
Score: 6.1 Sequence: AATATGTTATGTTATAACATTTA
Locus tag: Bfl040
|
||||
| Bfl040 | -172 | 6.1 | AATATGTTATGTTATAACATTTA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: znuC2 | ||||
| Ortholog function: putative zinc ABC transporter, ATP-binding protein | ||||
| Citrobacter koseri ATCC BAA-895 | CKO_04054 | -141 | 6.1 | TTATTGTTATGTTATAACATTTT |
| Citrobacter koseri ATCC BAA-895 | CKO_00951 | -45 | 5.7 | CATTTGTTATGTTATAACGTTAC |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_03035 | -108 | 6 | TTATTGTTATGTTATAACATTAA |
| Enterobacter sp. 638 | Ent638_3178 | -140 | 5.9 | TTAGTGTTATGTTATAACATTAT |
| Serratia proteamaculans 568 | Spro_1121 | -185 | 5.8 | GTGATGTTATAATGTAACACTTA |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA3756 | -123 | 6.5 | GATATGTTATAATATAACAATTA |