Propagation of TrpR regulog to Escherichia coli O157:H7 str. Sakai
Source regulog: | TrpR - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | TrpR |
Regulation mode: | repressor |
Biological process: | Tryptophan biosynthesis |
Effector: | Tryptophan |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Escherichia coli O157:H7 str. Sakai |
Orthologous TF(s) | ECs5351 |
Regulated genes | 3 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -79
Score: 5.6 Sequence: TGTACTAGTTTGATGGTATG
Locus tag: ECs0438
|
||||
ECs0438 | -79 | 5.6 | TGTACTAGTTTGATGGTATG | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: aroL | ||||
Ortholog function: Shikimate kinase III (EC 2.7.1.71) | ||||
Escherichia coli str. K-12 substr. MG1655 | b0388 | -79 | 5.6 | TGTACTAGTTTGATGGTATG |
Salmonella typhimurium LT2 | STM0388 | -79 | 5.1 | TGTACTAGTTAGATGATATG |
Citrobacter koseri ATCC BAA-895 | CKO_02783 | -136 | 5.4 | TGTACTAGTTTGGTGGTATG |
Enterobacter sp. 638 | Ent638_0859 | -80 | 5.6 | CGTACTAGTTTAATGGTATT |
Position: -72
Score: 5.4 Sequence: TGTACTCGCGTACTGGTACA
Locus tag: ECs4042
|
||||
ECs4042 | -72 | 5.4 | TGTACTCGCGTACTGGTACA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: mtr | ||||
Ortholog function: Tryptophan-specific transport protein | ||||
Escherichia coli str. K-12 substr. MG1655 | b3161 | -72 | 5.9 | TGTACTCGTGTACTGGTACA |
Salmonella typhimurium LT2 | STM3279 | -72 | 5.9 | TGTACTCGTGTACTGGTACA |
Citrobacter koseri ATCC BAA-895 | CKO_04558 | -72 | 5.4 | TGTACTCGCGTACTGGTACA |
Enterobacter sp. 638 | Ent638_3598 | -71 | 5.4 | TGTACTCCTGTACTGGTACA |
Position: -66
Score: 5.3 Sequence: CGTACTCTTTAGCGAGTACA
Locus tag: ECs5351
|
||||
ECs5351 | -66 | 5.3 | CGTACTCTTTAGCGAGTACA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: trpR | ||||
Ortholog function: Trp operon repressor | ||||
Escherichia coli str. K-12 substr. MG1655 | b4393 | -66 | 5.3 | CGTACTCTTTAGCGAGTACA |
Salmonella typhimurium LT2 | STM4583 | -34 | 5.6 | TGTACTCGTGTAACAGTACA |
Citrobacter koseri ATCC BAA-895 | CKO_03393 | -97 | 6 | CGTACTCGTTAAAGAGTACA |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04848 | -65 | 5.7 | TGTACTCGTTGAAGAGTACA |
Enterobacter sp. 638 | Ent638_0554 | 3 | 5.5 | TGTACTcGTcAAagAGTACA |
Erwinia amylovora ATCC 49946 | EAM_0634 | -33 | 6.2 | TGTACTAGTTAAATAGTATG |
Yersinia pestis KIM | y3726 | -24 | 6.1 | TGTACTAGTTAAATAGTACT |
Serratia proteamaculans 568 | Spro_0676 | -30 | 6.2 | TGTACTAGTTAAATAGTATG |
Erwinia carotovora subsp. atroseptica SCRI1043 | ECA3899 | -30 | 6.2 | CGTACTAGTTAAATAGTATG |
Edwardsiella tarda EIB202 | ETAE_0543 | -44 | 5.6 | TGTACTCGTTGAATAGTTCA |
Proteus mirabilis HI4320 | PMI3714 | -39 | 5.2 | TGTACTAGTTTATGAGTGTG |
Photorhabdus luminescens subsp. laumondii TTO1 | plu0557 | -34 | 6.2 | TGTACTAGTTAAATAGTATG |