Propagation of MntR regulog to Salmonella enterica subsp. enterica serovar Paratyphi B str. SPB7

Reference regulog properties
Source regulog:	MntR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Salmonella enterica subsp. enterica serovar Paratyphi B str. SPB7
Orthologous TF(s)	SPAB_02662
Regulated genes	1

Built upon 35 sites [see more]

Predicted regulatory interactions in *Salmonella enterica subsp. enterica serovar Paratyphi B str. SPB7*
	Locus tag	Position	Score	Sequence
Position: -128 Score: 6.8 Sequence: AGATATAGCACAGGCTATGTTT Locus tag: SPAB_02662
	SPAB_02662	-128	6.8	AGATATAGCACAGGCTATGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntR
Ortholog function: Manganese homeostasis transcriptional regulator MntR, DtxR family
Salmonella typhimurium LT2	STM0835	-128	6.8	AGATATAGCACAGGCTATGTTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --