Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MntR regulog to Salmonella enterica subsp. enterica serovar Paratyphi B str. SPB7

Reference regulog properties
Source regulog: MntR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Paratyphi B str. SPB7
Orthologous TF(s) SPAB_02662
Regulated genes 1
Built upon 35 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Paratyphi B str. SPB7
Locus tag Position Score Sequence
Position: -128
Score: 6.8
Sequence: AGATATAGCACAGGCTATGTTT
Locus tag: SPAB_02662
SPAB_02662 -128 6.8 AGATATAGCACAGGCTATGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntR
Ortholog function: Manganese homeostasis transcriptional regulator MntR, DtxR family
Salmonella typhimurium LT2 STM0835 -128 6.8 AGATATAGCACAGGCTATGTTT