Propagation of MntR regulog to Salmonella enterica subsp. enterica serovar Paratyphi B str. SPB7
| Source regulog: | MntR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Salmonella enterica subsp. enterica serovar Paratyphi B str. SPB7 |
| Orthologous TF(s) | SPAB_02662 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -128
Score: 6.8 Sequence: AGATATAGCACAGGCTATGTTT
Locus tag: SPAB_02662
|
||||
| SPAB_02662 | -128 | 6.8 | AGATATAGCACAGGCTATGTTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: mntR | ||||
| Ortholog function: Manganese homeostasis transcriptional regulator MntR, DtxR family | ||||
| Salmonella typhimurium LT2 | STM0835 | -128 | 6.8 | AGATATAGCACAGGCTATGTTT |