Propagation of SoxR regulog to Salmonella enterica subsp. enterica serovar Paratyphi B str. SPB7
Source regulog: | SoxR - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | MerR |
Regulation mode: | activator (repressor) |
Biological process: | Superoxide stress response |
Effector: | Paraquat |
Phylum: | Proteobacteria/Gamma |
Propagated regulon: | |
Target genome | Salmonella enterica subsp. enterica serovar Paratyphi B str. SPB7 |
Orthologous TF(s) | SPAB_05257 |
Regulated genes | 2 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -76
Score: 7.4 Sequence: ACCTCAAGTTAACTTGAGGA
Locus tag: SPAB_05256
|
||||
SPAB_05256 | -76 | 7.4 | ACCTCAAGTTAACTTGAGGA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: soxS | ||||
Ortholog function: Transcriptional activator of superoxide response regulon, AraC family | ||||
Escherichia coli str. K-12 substr. MG1655 | b4062 | -75 | 7.4 | ACCTCAAGTTAACTTGAGGA |
Salmonella typhimurium LT2 | STM4265 | -76 | 7.4 | ACCTCAAGTTAACTTGAGGA |
Citrobacter koseri ATCC BAA-895 | CKO_03828 | -76 | 7.4 | ACCTCAAGTTAACTTGAGGA |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04462 | -74 | 7.4 | ACCTCAAGTTAACTTGAGGA |
Enterobacter sp. 638 | Ent638_0266 | -87 | 7.4 | ACCTCAAGTTAACTTGAGGA |
Erwinia amylovora ATCC 49946 | EAM_0316 | -92 | 7.1 | ACCTCAAGTAAACTTGAGGA |
Position: -30
Score: 7.4 Sequence: TCCTCAAGTTAACTTGAGGT
Locus tag: SPAB_05257
|
||||
SPAB_05257 | -30 | 7.4 | TCCTCAAGTTAACTTGAGGT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: soxR | ||||
Ortholog function: Redox-sensitive transcriptional activator, MerR family | ||||
Escherichia coli str. K-12 substr. MG1655 | b4063 | -30 | 7.4 | TCCTCAAGTTAACTTGAGGT |
Salmonella typhimurium LT2 | STM4266 | -30 | 7.4 | TCCTCAAGTTAACTTGAGGT |
Citrobacter koseri ATCC BAA-895 | CKO_03827 | -30 | 7.4 | TCCTCAAGTTAACTTGAGGT |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04463 | -57 | 7.4 | TCCTCAAGTTAACTTGAGGT |
Enterobacter sp. 638 | Ent638_0267 | -31 | 7.4 | TCCTCAAGTTAACTTGAGGT |
Erwinia amylovora ATCC 49946 | EAM_0317 | -30 | 7.1 | TCCTCAAGTTTACTTGAGGT |