Propagation of GalR/GalS regulog to Yersinia pestis biovar Medievalis str. 91001

Reference regulog properties
Source regulog:	GalR/GalS - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor (activator)
Biological process:	Galactose utilization
Effector:	Galactose
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Yersinia pestis biovar Medievalis str. 91001
Orthologous TF(s)	YP2862
Regulated genes	2

Built upon 78 sites [see more]

Predicted regulatory interactions in *Yersinia pestis biovar Medievalis str. 91001*
	Locus tag	Position	Score	Sequence
Position: -95 Score: 6.4 Sequence: GAGTGTAAACGATTCCATTA Locus tag: YP1020
	YP1020	-95	6.4	GAGTGTAAACGATTCCATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: galE
Ortholog function: UDP-galactose-4-epimerase
Escherichia coli str. K-12 substr. MG1655	b0759	-96	6.6	TTGTGTAAACGATTCCACTA
Salmonella typhimurium LT2	STM0776	-96	6.4	GTGTGTAAACGATTCCACTA
Citrobacter koseri ATCC BAA-895	CKO_02376	-54	6.4	AAGTGTAAACGATTCCACTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_00773	-252	4.9	CAGTGGAGACGGTTACACTT
		-96	6.4	AAGTGTAAACGATTCCACTA
Enterobacter sp. 638	Ent638_1250	-96	6.2	CGGTGTAACCGATTCCACTA
Yersinia pestis KIM	y3043	-95	6.4	GAGTGTAAACGATTCCATTA
Edwardsiella tarda EIB202	ETAE_2564	-195	5.5	TAGTGTAAGCGATACCACAA
		-95	6.4	TAGTGTAAACGATTCCATTT

Position: -229 Score: 5.8 Sequence: TTGTGTAACCGGTTTCAATC Locus tag: YP1397
	YP1397	-229	5.8	TTGTGTAACCGGTTTCAATC
Supported by regulated orthologs from reference regulons
Ortholog gene name: mglB
Ortholog function: beta-methylgalactoside ABC transporter, periplasmic binding protein
Escherichia coli str. K-12 substr. MG1655	b2150	-287	5.3	CGATGTAACCGCTTTCAATC
Citrobacter koseri ATCC BAA-895	CKO_00641	-287	5.5	GGATGTAACCGCTTTCAATA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_02588	-256	5.4	GGATGTAACCGCTTTCAATT
Enterobacter sp. 638	Ent638_2750	-288	5.8	TGATGTAACCGTTTTCAATC
Yersinia pestis KIM	y2662	-229	5.8	TTGTGTAACCGGTTTCAATC
Serratia proteamaculans 568	Spro_1563	-246	6.1	TTGTGTAACCGTTTTCAATC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --