Propagation of QorR regulog to Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853
| Source regulog: | QorR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | HxlR |
| Regulation mode: | repressor |
| Biological process: | Energy metabolism |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 |
| Orthologous TF(s) | No orthologous TFs found |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -67
Score: 6.6 Sequence: GTACTTACTAAAAGTAAGTTT
Locus tag: SeD_A4799
|
||||
| SeD_A4799 | -67 | 6.6 | GTACTTACTAAAAGTAAGTTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: qorB | ||||
| Ortholog function: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) | ||||
| Citrobacter koseri ATCC BAA-895 | CKO_03618 | -34 | 6.6 | GTACTTACTAAAAGTAAGTTT |
| Enterobacter sp. 638 | Ent638_0383 | -67 | 6.3 | GTACTTACTATAAGTTAGTTA |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA4449 | -81 | 6.1 | GTACTTACTTAAAGTTAGCTT |
| Escherichia coli str. K-12 substr. MG1655 | b4211 | -67 | 6.6 | GTACTTACTAAAAGTAAGTTT |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04605 | -68 | 6.3 | GTACTTACTAAAAGTTAGTTA |
| Proteus mirabilis HI4320 | PMI0976 | -68 | 6.6 | GTACTTACTTTTAGTAAGTTT |
| Salmonella typhimurium LT2 | STM4401 | -67 | 6.6 | GTACTTACTAAAAGTAAGTTT |
| Yersinia pestis KIM | y1806 | -119 | 5.9 | GTACTTACGTAAAGTGAGTAT |