Propagation of SorC regulog to Klebsiella variicola At-22
| Source regulog: | SorC - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | SorC |
| Regulation mode: | activator (repressor) |
| Biological process: | Sorbose utilization |
| Effector: | Sorbose |
| Phylum: | Proteobacteria |
| Propagated regulon: | |
| Target genome | Klebsiella variicola At-22 |
| Orthologous TF(s) | Kvar_4838 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -28
Score: 6.5 Sequence: ATTTGCACAAATGTGCAGGA
Locus tag: Kvar_4838
|
||||
| Kvar_4838 | -28 | 6.5 | ATTTGCACAAATGTGCAGGA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: sorC | ||||
| Ortholog function: Sorbitol utilization transcriptional regulator, SorC family | ||||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04408 | -28 | 6.5 | ATTTGCACAAATGTGCAGGA |