Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of QorR regulog to Escherichia coli SE11

Reference regulog properties
Source regulog: QorR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: HxlR
Regulation mode: repressor
Biological process: Energy metabolism
Effector:
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Escherichia coli SE11
Orthologous TF(s) ECSE_4518
Regulated genes 2
Built upon 15 sites [see more]
Predicted regulatory interactions in Escherichia coli SE11
Locus tag Position Score Sequence
Position: -67
Score: 6.6
Sequence: GTACTTACTAAAAGTAAGTTT
Locus tag: ECSE_4517
ECSE_4517 -67 6.6 GTACTTACTAAAAGTAAGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: qorB
Ortholog function: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
Citrobacter koseri ATCC BAA-895 CKO_03618 -34 6.6 GTACTTACTAAAAGTAAGTTT
Enterobacter sp. 638 Ent638_0383 -67 6.3 GTACTTACTATAAGTTAGTTA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA4449 -81 6.1 GTACTTACTTAAAGTTAGCTT
Escherichia coli str. K-12 substr. MG1655 b4211 -67 6.6 GTACTTACTAAAAGTAAGTTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04605 -68 6.3 GTACTTACTAAAAGTTAGTTA
Proteus mirabilis HI4320 PMI0976 -68 6.6 GTACTTACTTTTAGTAAGTTT
Salmonella typhimurium LT2 STM4401 -67 6.6 GTACTTACTAAAAGTAAGTTT
Yersinia pestis KIM y1806 -119 5.9 GTACTTACGTAAAGTGAGTAT
Position: -42
Score: 6.6
Sequence: AAACTTACTTTTAGTAAGTAC
Locus tag: ECSE_4518
ECSE_4518 -42 6.6 AAACTTACTTTTAGTAAGTAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: qorR
Ortholog function: Redox-sensing transcriptional regulator QorR, HxlR family
Citrobacter koseri ATCC BAA-895 CKO_03617 -43 6.6 AAACTTACTTTTAGTAAGTAC
Enterobacter sp. 638 Ent638_0384 -37 6.3 TAACTAACTTATAGTAAGTAC
Erwinia carotovora subsp. atroseptica SCRI1043 ECA4450 -40 6.1 AAGCTAACTTTAAGTAAGTAC
Escherichia coli str. K-12 substr. MG1655 b4212 -42 6.6 AAACTTACTTTTAGTAAGTAC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04606 -42 6.3 TAACTAACTTTTAGTAAGTAC
Proteus mirabilis HI4320 PMI0975 -42 6.6 AAACTTACTAAAAGTAAGTAC
Salmonella typhimurium LT2 STM4402 -41 6.6 AAACTTACTTTTAGTAAGTAC