Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of YtrA regulog to Bacillus cereus W

Reference regulog properties
Source regulog: YtrA - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Ramoplanin resistance
Effector: Ramoplanin
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus cereus W
Orthologous TF(s) BcerW_010100015719
Regulated genes 1
Built upon 8 sites [see more]
Predicted regulatory interactions in Bacillus cereus W
Locus tag Position Score Sequence
Position: -52
Score: 5.8
Sequence: TGTACTACATACATTAGTACA
Locus tag: BcerW_010100015719
BcerW_010100015719 -52 5.8 TGTACTACATACATTAGTACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ytrA
Ortholog function: Transcriptional regulator, GntR family
Bacillus subtilis subsp. subtilis str. 168 BSU30460 -244 6.5 TGTACTAATTGAAGTAATACA
Bacillus amyloliquefaciens FZB42 RBAM_027400 -238 6.7 TGTACTACTTGATGTAATACA
Bacillus pumilus SAFR-032 BPUM_2677 -234 6.4 TGTACTACATCAACTAATACA
Bacillus licheniformis DSM 13 BLi03185 -223 6.4 TGTACTACATCGAGTAATACA
Geobacillus kaustophilus HTA426 GK1620 -49 5.9 TGTACTATTAGTTATAGTACG
Bacillus cereus ATCC 14579 BC4076 -46 6.4 TGTATTACATATAGTAGTACA
© 2009-2020 RegPrecise