Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of Zur regulog to Yersinia pestis Angola

Reference regulog properties
Source regulog: Zur - Enterobacteriales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Yersinia pestis Angola
Orthologous TF(s) YpAngola_A1301
Regulated genes 3
Built upon 65 sites [see more]
Predicted regulatory interactions in Yersinia pestis Angola
Locus tag Position Score Sequence
Position: 6
Score: 5.1
Sequence: TATGTGTTACATTATAACGGTTT
Locus tag: YpAngola_A0440
YpAngola_A0440 6 5.1 TATGTGTTACATTATAACGGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ECA3248
Ortholog function: ABC-type uncharacterized transport system, periplasmic component
Yersinia pestis KIM y1329 6 5.1 TATGTGTTACATTATAACGGTTT
Serratia proteamaculans 568 Spro_3632 -3 5.3 TTTATGTTACTTTATAACAATAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3248 -3 5.7 ATAATGTTACATTATAACGCTTT
Proteus mirabilis HI4320 PMI1519 -42 6.1 GTGATGTTATATTATAACAAAAT
Position: -44
Score: 5.7
Sequence: AAAGCGTAATATTATAACATTCA
Locus tag: YpAngola_A2418
YpAngola_A2418 -44 5.7 AAAGCGTAATATTATAACATTCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: znuC
Ortholog function: high-affinity zinc ABC transporter, ATP-binding protein
Escherichia coli str. K-12 substr. MG1655 b1858 -49 6.5 GAAGTGTGATATTATAACATTTC
Salmonella typhimurium LT2 STM1892.S -49 6.7 GAAATGTGATATTATAACATTCT
Citrobacter koseri ATCC BAA-895 CKO_01105 -49 6.7 GAAATGTGATATTATAACATTCT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02373 -49 6.4 GTGATGTGATATTATAACATTCA
Enterobacter sp. 638 Ent638_2427 -48 6.2 TGGATGTGATATTATAACATTCG
Erwinia amylovora ATCC 49946 EAM_2001 -48 6.1 ATTTTGTGATATTATAACATTTG
Yersinia pestis KIM y2250 -47 5.7 AAAGCGTAATATTATAACATTCA
Serratia proteamaculans 568 Spro_2774 -50 5.8 GAGGCGTGATATTATAACATTCG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2485 -46 6.4 TGTTTGTTATATTATAACATTAC
Edwardsiella tarda EIB202 ETAE_1442 -72 6.7 GAAACGTTATATTATAACATTCC
Proteus mirabilis HI4320 PMI1151 -47 6.7 GAAATGTTATATTATAACGTTTC
Photorhabdus luminescens subsp. laumondii TTO1 plu2114 -48 6.6 GAATTGTTATATTATAACATCTC
Position: -312
Score: 5.9
Sequence: ATGATGTTACATTATAACATACT
Locus tag: YpAngola_A3032
YpAngola_A3032 -312 5.9 ATGATGTTACATTATAACATACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: rpmJ2
Ortholog function: 50S ribosomal protein L36 paralog
Salmonella typhimurium LT2 STM0470 -35 5.8 TTATTGTTATGTTATAACATAAT
Citrobacter koseri ATCC BAA-895 CKO_02695 -35 5.5 TTATTGTTACGTTATAACATAAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00436 -35 5.5 TTATTGTTATGTTATAACGTAAT
Enterobacter sp. 638 Ent638_0935 -37 5.6 CTTTTGTTATGTTATAACAAAAC
Erwinia amylovora ATCC 49946 EAM_1014 -36 6 TTTTGGTTATATTATAACATATC
Serratia proteamaculans 568 Spro_1124 -36 6.2 TTATTGTTATAGTATAACATTAC
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1167 -31 6 GATATGTTATAACATAACAATTG
Edwardsiella tarda EIB202 ETAE_1964 -148 5.9 GTATTGTTATAACATAACATATG