Propagation of QorR regulog to Escherichia coli O26:H11 str. 11368
Source regulog: | QorR - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | HxlR |
Regulation mode: | repressor |
Biological process: | Energy metabolism |
Effector: | |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Escherichia coli O26:H11 str. 11368 |
Orthologous TF(s) | ECO26_5382 |
Regulated genes | 2 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -67
Score: 6.6 Sequence: GTACTTACTAAAAGTAAGTTT
Locus tag: ECO26_5381
|
||||
ECO26_5381 | -67 | 6.6 | GTACTTACTAAAAGTAAGTTT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: qorB | ||||
Ortholog function: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) | ||||
Citrobacter koseri ATCC BAA-895 | CKO_03618 | -34 | 6.6 | GTACTTACTAAAAGTAAGTTT |
Enterobacter sp. 638 | Ent638_0383 | -67 | 6.3 | GTACTTACTATAAGTTAGTTA |
Erwinia carotovora subsp. atroseptica SCRI1043 | ECA4449 | -81 | 6.1 | GTACTTACTTAAAGTTAGCTT |
Escherichia coli str. K-12 substr. MG1655 | b4211 | -67 | 6.6 | GTACTTACTAAAAGTAAGTTT |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04605 | -68 | 6.3 | GTACTTACTAAAAGTTAGTTA |
Proteus mirabilis HI4320 | PMI0976 | -68 | 6.6 | GTACTTACTTTTAGTAAGTTT |
Salmonella typhimurium LT2 | STM4401 | -67 | 6.6 | GTACTTACTAAAAGTAAGTTT |
Yersinia pestis KIM | y1806 | -119 | 5.9 | GTACTTACGTAAAGTGAGTAT |
Position: -42
Score: 6.6 Sequence: AAACTTACTTTTAGTAAGTAC
Locus tag: ECO26_5382
|
||||
ECO26_5382 | -42 | 6.6 | AAACTTACTTTTAGTAAGTAC | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: qorR | ||||
Ortholog function: Redox-sensing transcriptional regulator QorR, HxlR family | ||||
Citrobacter koseri ATCC BAA-895 | CKO_03617 | -43 | 6.6 | AAACTTACTTTTAGTAAGTAC |
Enterobacter sp. 638 | Ent638_0384 | -37 | 6.3 | TAACTAACTTATAGTAAGTAC |
Erwinia carotovora subsp. atroseptica SCRI1043 | ECA4450 | -40 | 6.1 | AAGCTAACTTTAAGTAAGTAC |
Escherichia coli str. K-12 substr. MG1655 | b4212 | -42 | 6.6 | AAACTTACTTTTAGTAAGTAC |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04606 | -42 | 6.3 | TAACTAACTTTTAGTAAGTAC |
Proteus mirabilis HI4320 | PMI0975 | -42 | 6.6 | AAACTTACTAAAAGTAAGTAC |
Salmonella typhimurium LT2 | STM4402 | -41 | 6.6 | AAACTTACTTTTAGTAAGTAC |