Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of GalR/GalS regulog to Salmonella enterica subsp. enterica serovar Typhi str. E98-2068

Reference regulog properties
Source regulog: GalR/GalS - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor (activator)
Biological process: Galactose utilization
Effector: Galactose
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Typhi str. E98-2068
Orthologous TF(s) SentesTyp_010100001108, SentesTyp_010100025442, SentesTyp_010100035729
Regulated genes 2
Built upon 78 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Typhi str. E98-2068
Locus tag Position Score Sequence
Position: -96
Score: 6.2
Sequence: GCGTGTAAACGATTCCACTA
Locus tag: SentesTyp_010100012934
SentesTyp_010100012934 -96 6.2 GCGTGTAAACGATTCCACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: galE
Ortholog function: UDP-galactose-4-epimerase
Escherichia coli str. K-12 substr. MG1655 b0759 -96 6.6 TTGTGTAAACGATTCCACTA
Salmonella typhimurium LT2 STM0776 -96 6.4 GTGTGTAAACGATTCCACTA
Citrobacter koseri ATCC BAA-895 CKO_02376 -54 6.4 AAGTGTAAACGATTCCACTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00773 -252 4.9 CAGTGGAGACGGTTACACTT
-96 6.4 AAGTGTAAACGATTCCACTA
Enterobacter sp. 638 Ent638_1250 -96 6.2 CGGTGTAACCGATTCCACTA
Yersinia pestis KIM y3043 -95 6.4 GAGTGTAAACGATTCCATTA
Edwardsiella tarda EIB202 ETAE_2564 -195 5.5 TAGTGTAAGCGATACCACAA
-95 6.4 TAGTGTAAACGATTCCATTT
Position: -33
Score: 5.3
Sequence: TAATGTAAGCGTTTACCCAC
Locus tag: SentesTyp_010100035729
SentesTyp_010100035729 -33 5.3 TAATGTAAGCGTTTACCCAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: galR
Ortholog function: galactose operon repressor galR
Escherichia coli str. K-12 substr. MG1655 b2837 -32 5.2 GAATGTAAGCGTTTACCCAC
Salmonella typhimurium LT2 STM3011 -33 5.3 TAATGTAAGCGTTTACCCAC
Citrobacter koseri ATCC BAA-895 CKO_04211 -33 5.1 AAATGTAAGCGTTTACCCAC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03246 -33 5.5 GTATGTAAACGCTTACCCTA
Enterobacter sp. 638 Ent638_3278 -35 5.3 GTGTGTAAACGCTTACCCCC
Erwinia amylovora ATCC 49946 EAM_2770 -35 4.9 AAATGTAAACGCTTACCCAG
Yersinia pestis KIM y3183 32 5.4 TGATGTAAGCGGTTACCCTA
Serratia proteamaculans 568 Spro_3832 -34 5.2 GAATGTAAGCGATTACCCAG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3172 -240 5.3 AAGTGTAATCGGTTACCCTA
Edwardsiella tarda EIB202 ETAE_2890 -41 5.2 TGGTGTAAACGTTTACGGTT
© 2009-2020 RegPrecise