Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of XapR regulog to Salmonella enterica subsp. enterica serovar Typhi str. J185

Reference regulog properties
Source regulog: XapR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LysR
Regulation mode: activator
Biological process: Xanthosine utilization
Effector: Deoxyinosine; Xanthosine
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Typhi str. J185
Orthologous TF(s) SentesTy_010100028703
Regulated genes 1
Built upon 5 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Typhi str. J185
Locus tag Position Score Sequence
Position: -107
Score: 6
Sequence: TCGATATTAAATGGCTATTGA
Locus tag: SentesTy_010100028688
SentesTy_010100028688 -107 6 TCGATATTAAATGGCTATTGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: xapA
Ortholog function: Xanthosine phosphorylase (EC 2.4.2.1)
Citrobacter koseri ATCC BAA-895 CKO_00389 -120 6.2 TCAATATACATTTTATATCGA
Edwardsiella tarda EIB202 ETAE_2779 -115 4.4 TCCCTAGCAAATCAATACTGA
Enterobacter sp. 638 Ent638_2934 -121 5.2 TTGATACTGAAAGAGTATTGA
Escherichia coli str. K-12 substr. MG1655 b2407 -132 4.2 TTAATAGAGAAAAGATATAAA
-107 5.9 TCGATATCGAATCGCTATTGA