Propagation of PhnR regulog to Salmonella enterica subsp. enterica serovar Typhi str. J185

Reference regulog properties
Source regulog:	PhnR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:	2-aminoethylphosphonate
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Salmonella enterica subsp. enterica serovar Typhi str. J185
Orthologous TF(s)	SentesTy_010100020177
Regulated genes	2

Built upon 6 sites [see more]

Predicted regulatory interactions in *Salmonella enterica subsp. enterica serovar Typhi str. J185*
	Locus tag	Position	Score	Sequence
Position: -131 Score: 5.3 Sequence: CCTTTGGTCTATACCAGATT Locus tag: SentesTy_010100020177
	SentesTy_010100020177	-131	5.3	CCTTTGGTCTATACCAGATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: phnR
Ortholog function: 2-aminoethylphosphonate utilization regulator, GntR family
Salmonella typhimurium LT2	STM0430	-131	5.3	CCTTTGGTCTATACCAGATT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_04062	-153	5.8	CATTTGGTCTATACCAGATT

Position: -28 Score: 6.2 Sequence: AATCTGGTATAGACCAAAGG Locus tag: SentesTy_010100020182
	SentesTy_010100020182	-28	6.2	AATCTGGTATAGACCAAAGG
Supported by regulated orthologs from reference regulons
Ortholog gene name: phnW
Ortholog function: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
Salmonella typhimurium LT2	STM0431	-28	6.2	AATCTGGTATAGACCAAAGG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_04063	-29	6.5	AATCTGGTATAGACCAAATG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --