Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of NikR regulog to Salmonella enterica subsp. enterica serovar Typhi str. J185

Reference regulog properties
Source regulog: NikR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: NikR
Regulation mode: repressor
Biological process: Nickel homeostasis
Effector: Nickel ion, (Ni2+)
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Typhi str. J185
Orthologous TF(s) SentesTy_010100013719
Regulated genes 1
Built upon 9 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Typhi str. J185
Locus tag Position Score Sequence
Position: -187
Score: 6.2
Sequence: GTGTGACGTTTTAATCAAATGATCATAC
Locus tag: SentesTy_010100024238
SentesTy_010100024238 -187 6.2 GTGTGACGTTTTAATCAAATGATCATAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: nxiA
Ortholog function: high-affinity nickel-transporter
Salmonella typhimurium LT2 STM2783 -79 6.2 GTGTGACGTTTTAATCAAATGATCATAC
Edwardsiella tarda EIB202 ETAE_2654 -120 6.9 GTATGACAATTTCATGAAAAGATCATAC