Propagation of SoxR regulog to Enterobacter sp. 638

Reference regulog properties
Source regulog:	SoxR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Phylum:	Proteobacteria/Gamma
Propagated regulon:
Target genome	Enterobacter sp. 638
Orthologous TF(s)	Ent638_0267
Regulated genes	3

Built upon 14 sites [see more]

Predicted regulatory interactions in *Enterobacter sp. 638*
	Locus tag	Position	Score	Sequence
Position: -87 Score: 7.4 Sequence: ACCTCAAGTTAACTTGAGGA Locus tag: Ent638_0266
	Ent638_0266	-87	7.4	ACCTCAAGTTAACTTGAGGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: soxS
Ortholog function: Transcriptional activator of superoxide response regulon, AraC family
Escherichia coli str. K-12 substr. MG1655	b4062	-75	7.4	ACCTCAAGTTAACTTGAGGA
Salmonella typhimurium LT2	STM4265	-76	7.4	ACCTCAAGTTAACTTGAGGA
Citrobacter koseri ATCC BAA-895	CKO_03828	-76	7.4	ACCTCAAGTTAACTTGAGGA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_04462	-74	7.4	ACCTCAAGTTAACTTGAGGA
Enterobacter sp. 638	Ent638_0266	-87	7.4	ACCTCAAGTTAACTTGAGGA
Erwinia amylovora ATCC 49946	EAM_0316	-92	7.1	ACCTCAAGTAAACTTGAGGA

Position: -31 Score: 7.4 Sequence: TCCTCAAGTTAACTTGAGGT Locus tag: Ent638_0267
	Ent638_0267	-31	7.4	TCCTCAAGTTAACTTGAGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: soxR
Ortholog function: Redox-sensitive transcriptional activator, MerR family
Escherichia coli str. K-12 substr. MG1655	b4063	-30	7.4	TCCTCAAGTTAACTTGAGGT
Salmonella typhimurium LT2	STM4266	-30	7.4	TCCTCAAGTTAACTTGAGGT
Citrobacter koseri ATCC BAA-895	CKO_03827	-30	7.4	TCCTCAAGTTAACTTGAGGT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_04463	-57	7.4	TCCTCAAGTTAACTTGAGGT
Enterobacter sp. 638	Ent638_0267	-31	7.4	TCCTCAAGTTAACTTGAGGT
Erwinia amylovora ATCC 49946	EAM_0317	-30	7.1	TCCTCAAGTTTACTTGAGGT

Position: -64 Score: 6.3 Sequence: ACCTCAAGTTAACTTTAGCT Locus tag: Ent638_2697
	Ent638_2697	-64	6.3	ACCTCAAGTTAACTTTAGCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: PF00903
Ortholog function: Glyoxalase/bleomycin resistance protein/dioxygenase
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_01861	-59	6.9	ATCTCAAGTTAACTTGAGGT
Enterobacter sp. 638	Ent638_2697	-64	6.3	ACCTCAAGTTAACTTTAGCT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Propagation of SoxR regulog to Enterobacter sp. 638

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --