Propagation of TrpR regulog to Serratia proteamaculans 568
Source regulog: | TrpR - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | TrpR |
Regulation mode: | repressor |
Biological process: | Tryptophan biosynthesis |
Effector: | Tryptophan |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Serratia proteamaculans 568 |
Orthologous TF(s) | Spro_0676 |
Regulated genes | 3 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -30
Score: 6.2 Sequence: TGTACTAGTTAAATAGTATG
Locus tag: Spro_0676
|
||||
Spro_0676 | -30 | 6.2 | TGTACTAGTTAAATAGTATG | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: trpR | ||||
Ortholog function: Trp operon repressor | ||||
Escherichia coli str. K-12 substr. MG1655 | b4393 | -66 | 5.3 | CGTACTCTTTAGCGAGTACA |
Salmonella typhimurium LT2 | STM4583 | -34 | 5.6 | TGTACTCGTGTAACAGTACA |
Citrobacter koseri ATCC BAA-895 | CKO_03393 | -97 | 6 | CGTACTCGTTAAAGAGTACA |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04848 | -65 | 5.7 | TGTACTCGTTGAAGAGTACA |
Enterobacter sp. 638 | Ent638_0554 | 3 | 5.5 | TGTACTcGTcAAagAGTACA |
Erwinia amylovora ATCC 49946 | EAM_0634 | -33 | 6.2 | TGTACTAGTTAAATAGTATG |
Yersinia pestis KIM | y3726 | -24 | 6.1 | TGTACTAGTTAAATAGTACT |
Serratia proteamaculans 568 | Spro_0676 | -30 | 6.2 | TGTACTAGTTAAATAGTATG |
Erwinia carotovora subsp. atroseptica SCRI1043 | ECA3899 | -30 | 6.2 | CGTACTAGTTAAATAGTATG |
Edwardsiella tarda EIB202 | ETAE_0543 | -44 | 5.6 | TGTACTCGTTGAATAGTTCA |
Proteus mirabilis HI4320 | PMI3714 | -39 | 5.2 | TGTACTAGTTTATGAGTGTG |
Photorhabdus luminescens subsp. laumondii TTO1 | plu0557 | -34 | 6.2 | TGTACTAGTTAAATAGTATG |
Position: -219
Score: 6.2 Sequence: CGAACCAGTTAACTAGTACA
Locus tag: Spro_2667
|
||||
Spro_2667 | -219 | 6.2 | CGAACCAGTTAACTAGTACA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: trpE | ||||
Ortholog function: Anthranilate synthase, aminase component (EC 4.1.3.27) | ||||
Escherichia coli str. K-12 substr. MG1655 | b1264 | -183 | 6.3 | CGAACTAGTTAACTAGTACG |
Salmonella typhimurium LT2 | STM1723 | -186 | 6.3 | CGAACTAGTTAACTAGTACG |
Citrobacter koseri ATCC BAA-895 | CKO_01340 | -174 | 6.3 | CGAACTAGTTAACTAGTACG |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_01257 | -198 | 6.3 | CGAACTAGTTAACTAGTACG |
Enterobacter sp. 638 | Ent638_2204 | -186 | 6.3 | CGAACTAGTTAACTAGTACG |
Erwinia amylovora ATCC 49946 | EAM_1877 | -192 | 6.2 | CGAACCAGTTAACTAGTACA |
Yersinia pestis KIM | y2051 | -283 | 6.2 | TGAACCAGTTAACTAGTACA |
Serratia proteamaculans 568 | Spro_2667 | -219 | 6.2 | CGAACCAGTTAACTAGTACA |
Erwinia carotovora subsp. atroseptica SCRI1043 | ECA2296 | -231 | 6.2 | CGAACCAGTTAACTAGTACA |
Edwardsiella tarda EIB202 | ETAE_1535 | -222 | 5.6 | GAAACTAGTTTACTAGTACG |
Proteus mirabilis HI4320 | PMI1343 | -243 | 5.4 | TAATCCAGTTTACTAGTACA |
Photorhabdus luminescens subsp. laumondii TTO1 | plu2462 | -196 | 5.8 | CGTTCCAGTTTACTAGTACA |
Position: -58
Score: 5.3 Sequence: TGTACCATTGAGCTAGTACA
Locus tag: Spro_3236
|
||||
Spro_3236 | -58 | 5.3 | TGTACCATTGAGCTAGTACA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: mtr | ||||
Ortholog function: Tryptophan-specific transport protein | ||||
Yersinia pestis KIM | y2900 | -139 | 5 | TGTACCATTCAGCTAGTACA |
Serratia proteamaculans 568 | Spro_3236 | -58 | 5.3 | TGTACCATTGAGCTAGTACA |
Edwardsiella tarda EIB202 | ETAE_2287 | -48 | 4.8 | CGTACCATTGCGCTAGTACA |