Propagation of CymR regulog to Bacillus tusciae DSM 2912
| Source regulog: | CymR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Cysteine metabolism |
| Effector: | O-acetyl-L-serine; CysK, cysteine synthetase |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus tusciae DSM 2912 |
| Orthologous TF(s) | Btus_1094 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -130
Score: 4.9 Sequence: ATATTCCAATTAAACATATTTGTTATT
Locus tag: Btus_0193
|
||||
| Btus_0193 | -130 | 4.9 | ATATTCCAATTAAACATATTTGTTATT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: cysH | ||||
| Ortholog function: Phosphoadenylyl-sulfate reductase (EC 1.8.4.8) | ||||
| Bacillus amyloliquefaciens FZB42 | RBAM_015400 | -299 | 4.7 | TTATTCCTATCAAAAAACTCGGGTTGA |
| Anoxybacillus flavithermus WK1 | Aflv_0316 | -100 | 5.1 | AAATTCCGATAGAAAAACTAGGATTGA |
| Bacillus halodurans C-125 | BH1486 | -73 | 5.3 | TAAATCATATCAAATTACATGGAATTA |
| Bacillus clausii KSM-K16 | ABC0611 | -265 | 4.9 | AAATACCGAGTTTGTTAATCAGGATAA |
| Oceanobacillus iheyensis HTE831 | OB1652 | -98 | 5.4 | CAATTCACATTGTATTACTATGAATTA |
| Paenibacillus sp. JDR-2 | Pjdr2_5647 | -45 | 5.2 | AATAGCATATGAATTTACTTGGAATTA |