Propagation of FadR regulog to Bacillus tusciae DSM 2912
| Source regulog: | FadR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Palmitoyl-CoA; Oleoyl-CoA |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus tusciae DSM 2912 |
| Orthologous TF(s) | Btus_0427 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -44
Score: 5.9 Sequence: ATGAATGAATCACCATTCAT
Locus tag: Btus_0427
|
||||
| Btus_0427 | -44 | 5.9 | ATGAATGAATCACCATTCAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: fadR | ||||
| Ortholog function: Transcriptional regulator of fatty acids degradation, TetR family | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU28550 | -44 | 6.9 | ATGAATGAATAGTCATTCAT |
| Bacillus amyloliquefaciens FZB42 | RBAM_025610 | -38 | 6.9 | ATGAATGAATAGTCATTCAT |
| Bacillus pumilus SAFR-032 | BPUM_2512 | -41 | 6.8 | ATGAATGAATACTCATTCAA |
| Bacillus licheniformis DSM 13 | BLi03002 | -43 | 6.9 | ATGAATGAGTATTCATTCAT |
| Anoxybacillus flavithermus WK1 | Aflv_0565 | -44 | 6.9 | ATGAATGATTATTCATTCAT |
| Geobacillus kaustophilus HTA426 | GK2689 | -60 | 6.1 | ATGAATGATGGTTCATTCAT |
| Bacillus cereus ATCC 14579 | BC4525 | -45 | 6.6 | ATGAATGACTATTCATTCAG |
| Bacillus halodurans C-125 | BH3102 | -38 | 6.9 | ATGAATGAATACTCATTCAT |
| Bacillus clausii KSM-K16 | ABC2672 | -45 | 6.8 | ATGAATGAACATTCATTCAT |
| Oceanobacillus iheyensis HTE831 | OB2121 | -50 | 5.9 | ATGAATGATCATTCACTCAG |