Propagation of UlaR regulog to Salmonella enterica subsp. enterica serovar Typhi str. AG3

Reference regulog properties
Source regulog:	UlaR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	DeoR
Regulation mode:	repressor
Biological process:	Ascorbate utilization
Effector:	Ascorbate-6-phosphate
Phylum:	Proteobacteria
Propagated regulon:
Target genome	Salmonella enterica subsp. enterica serovar Typhi str. AG3
Orthologous TF(s)	No orthologous TFs found
Regulated genes	1

Built upon 13 sites [see more]

Predicted regulatory interactions in *Salmonella enterica subsp. enterica serovar Typhi str. AG3*
	Locus tag	Position	Score	Sequence
Position: -80 Score: 5.4 Sequence: TGATTACTTTTGAAAATTAA Locus tag: Salmonellaentericaenterica_010100010383
	Salmonellaentericaenterica_010100010383	-80	5.4	TGATTACTTTTGAAAATTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ulaA
Ortholog function: Ascorbate-specific PTS system, EIIC component
Citrobacter koseri ATCC BAA-895	CKO_03643	-82	5.3	TGATTACTTTTGAAAATTAG
Escherichia coli str. K-12 substr. MG1655	b4193	-82	5.3	TGATTACTTTTGAAAATTAG
Salmonella typhimurium LT2	STM4383.S	-80	5.4	TGATTACTTTTGAAAATTAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --