Propagation of GalR/GalS regulog to Salmonella enterica subsp. enterica serovar Typhi str. E98-3139

Reference regulog properties
Source regulog:	GalR/GalS - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor (activator)
Biological process:	Galactose utilization
Effector:	Galactose
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Salmonella enterica subsp. enterica serovar Typhi str. E98-3139
Orthologous TF(s)	Salmonellentericaenterica_010100019696, Salmonellentericaenterica_010100005119
Regulated genes	2

Built upon 78 sites [see more]

Predicted regulatory interactions in *Salmonella enterica subsp. enterica serovar Typhi str. E98-3139*
	Locus tag	Position	Score	Sequence
Position: -121 Score: 5.4 Sequence: GGCTGTAACCGTTTCCATCC Locus tag: Salmonellentericaenterica_010100005119
	Salmonellentericaenterica_010100005119	-121	5.4	GGCTGTAACCGTTTCCATCC
Supported by regulated orthologs from reference regulons
Ortholog gene name: galS
Ortholog function: galactose operon repressor galS
Escherichia coli str. K-12 substr. MG1655	b2151	-113	5.5	GGCTGTAACCGTTTCCATTG
Salmonella typhimurium LT2	STM2191	-121	5.4	GGCTGTAACCGTTTCCATCC
Citrobacter koseri ATCC BAA-895	CKO_00640	-124	4.9	GCATGTAACCGTTTCCAGCC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_02589	-127	5.2	GGATGTAAACGTTTCCAGCC
Enterobacter sp. 638	Ent638_2751	-127	5.5	GGATGTAACCGTTTTCATCT
Erwinia amylovora ATCC 49946	EAM_2208	-128	4.9	GGCTGTAACCGTTTTCATGG
Serratia proteamaculans 568	Spro_1562	-102	5.4	GTATGTAAACGTTTTCTTTC

Position: -96 Score: 6.2 Sequence: GCGTGTAAACGATTCCACTA Locus tag: Salmonellentericaenterica_010100016307
	Salmonellentericaenterica_010100016307	-96	6.2	GCGTGTAAACGATTCCACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: galE
Ortholog function: UDP-galactose-4-epimerase
Escherichia coli str. K-12 substr. MG1655	b0759	-96	6.6	TTGTGTAAACGATTCCACTA
Salmonella typhimurium LT2	STM0776	-96	6.4	GTGTGTAAACGATTCCACTA
Citrobacter koseri ATCC BAA-895	CKO_02376	-54	6.4	AAGTGTAAACGATTCCACTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_00773	-252	4.9	CAGTGGAGACGGTTACACTT
		-96	6.4	AAGTGTAAACGATTCCACTA
Enterobacter sp. 638	Ent638_1250	-96	6.2	CGGTGTAACCGATTCCACTA
Yersinia pestis KIM	y3043	-95	6.4	GAGTGTAAACGATTCCATTA
Edwardsiella tarda EIB202	ETAE_2564	-195	5.5	TAGTGTAAGCGATACCACAA
		-95	6.4	TAGTGTAAACGATTCCATTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Propagation of GalR/GalS regulog to Salmonella enterica subsp. enterica serovar Typhi str. E98-3139

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --