Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of CueR regulog to Escherichia coli O157:H7 str. EC4024

Reference regulog properties
Source regulog: CueR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Escherichia coli O157:H7 str. EC4024
Orthologous TF(s) EscherichcoliO157_010100026151, EscherichcoliO157_010100006251
Regulated genes 2
Built upon 30 sites [see more]
Predicted regulatory interactions in Escherichia coli O157:H7 str. EC4024
Locus tag Position Score Sequence
Position: -67
Score: 6.6
Sequence: ACCTTCCCCTTGCTGGAAGGT
Locus tag: EscherichcoliO157_010100006206
EscherichcoliO157_010100006206 -67 6.6 ACCTTCCCCTTGCTGGAAGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: copA
Ortholog function: Copper-translocating P-type ATPase (EC 3.6.3.4)
Escherichia coli str. K-12 substr. MG1655 b0484 -67 6.6 ACCTTCCCCTTGCTGGAAGGT
Position: -73
Score: 6.4
Sequence: ACCTTCCCGTAAGGGGAAGGA
Locus tag: EscherichcoliO157_010100017471
EscherichcoliO157_010100017471 -73 6.4 ACCTTCCCGTAAGGGGAAGGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: cueO
Ortholog function: Multicopper oxidase
Escherichia coli str. K-12 substr. MG1655 b0123 -73 6.4 ACCTTCCCGTAAGGGGAAGGA
Salmonella typhimurium LT2 STM0168 -62 6.5 ACCTTCCCGTTAGGGCAGGGT
Citrobacter koseri ATCC BAA-895 CKO_03244 -73 6.7 ACCTTCCCGTAAGGGGAGGGT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00131 -62 6.4 ACCTTCCCGTTACGGTAGGGT
Erwinia amylovora ATCC 49946 EAM_0777 -62 6.2 ACCTTCCCGCTGGGGCAGGGT
Yersinia pestis KIM y0777 -210 6.4 ACCTTCCCCTAAGAGGAGGGT
Serratia proteamaculans 568 Spro_3999 -118 6.3 ACCTTCCGCTAAGGGGAGGGT
Proteus mirabilis HI4320 PMI0159 -108 5.6 ACCTTCCAGTAAGGGGAGACT