Propagation of NiaR regulog to Bacillus tusciae DSM 2912
| Source regulog: | NiaR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | NiaR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Niacin |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus tusciae DSM 2912 |
| Orthologous TF(s) | Btus_1470 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -68
Score: 5.4 Sequence: TACACCTGTCTTGACATGTGAC
Locus tag: Btus_1471
|
||||
| Btus_1471 | -68 | 5.4 | TACACCTGTCTTGACATGTGAC | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: nadA | ||||
| Ortholog function: Quinolinate synthetase (EC 4.1.99.-) | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU27850 | -41 | 6.5 | TATAGGTGTCAAGACAGGTGTA |
| Bacillus amyloliquefaciens FZB42 | RBAM_024900 | -43 | 6.5 | TATAGGTGTCAAGACAGGTGTA |
| Bacillus pumilus SAFR-032 | BPUM_2425 | -38 | 5.9 | GATATGTGTCAAGACAGGTGTA |
| Bacillus licheniformis DSM 13 | BLi02912 | -42 | 6.6 | TATAGGTGTCAAGACACATGTA |
| Anoxybacillus flavithermus WK1 | Aflv_0705 | -49 | 4.4 | AATATATGTCAATATAGGTGTC |
| -37 | 5.5 | TATAGGTGTCAAGACAGTATGA | ||
| Geobacillus kaustophilus HTA426 | GK2599 | -41 | 6.1 | TATAGATGTCAAGACAGGTGAA |
| Bacillus cereus ATCC 14579 | BC4421 | -47 | 6.2 | TATAGGTGTCAAGACAGTTGGA |
| Bacillus halodurans C-125 | BH1220 | -39 | 6.4 | TATAGATGTCAAGACATATGTA |
| Bacillus clausii KSM-K16 | ABC1549 | -36 | 6.1 | TATAGGTGACAAGACAACTGTA |