Propagation of BetI regulog to Escherichia coli O157:H7 str. EC4113

Reference regulog properties
Source regulog:	BetI - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Glycine betaine synthesis
Effector:	Choline
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Escherichia coli O157:H7 str. EC4113
Orthologous TF(s)	EsccoliO157_010100012195
Regulated genes	2

Built upon 14 sites [see more]

Predicted regulatory interactions in *Escherichia coli O157:H7 str. EC4113*
	Locus tag	Position	Score	Sequence
Position: -66 Score: 6.6 Sequence: TATATTGAACGTCCAATCAA Locus tag: EsccoliO157_010100012195
	EsccoliO157_010100012195	-66	6.6	TATATTGAACGTCCAATCAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: betI
Ortholog function: transcriptional regulator of glycine betaine synthesis
Escherichia coli str. K-12 substr. MG1655	b0313	-66	6.6	TATATTGAACGTCCAATCAA
Citrobacter koseri ATCC BAA-895	CKO_02582	-48	6.6	TATATTGAACGTCCAATCAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_00586	-48	6.6	TATATTGAACGTCCAATCAA
Erwinia amylovora ATCC 49946	EAM_1685	-66	6.9	TTGATTGAACGTTCAATATA
Serratia proteamaculans 568	Spro_1513	-124	7	TTTATTGAACGTTCAATCAA
Erwinia carotovora subsp. atroseptica SCRI1043	ECA1744	-103	7	TTTATTGAACGTTCAATCAA
Proteus mirabilis HI4320	PMI1461	-68	6.5	TTGATTGAATGTTCAATTAA

Position: -82 Score: 6.7 Sequence: TTGATTGGACGTTCAATATA Locus tag: EsccoliO157_010100012205
	EsccoliO157_010100012205	-82	6.7	TTGATTGGACGTTCAATATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: betT
Ortholog function: choline transporter of high affinity
Escherichia coli str. K-12 substr. MG1655	b0314	-82	6.7	TTGATTGGACGTTCAATATA
Citrobacter koseri ATCC BAA-895	CKO_02581	-236	6.7	TTGATTGGACGTTCAATATA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_00587	-82	6.7	TTGATTGGACGTTCAATATA
Erwinia amylovora ATCC 49946	EAM_P133	-243	5.9	TTAATTGAATGCGCAATCAA
Serratia proteamaculans 568	Spro_1512	-308	7	TTGATTGAACGTTCAATAAA
Erwinia carotovora subsp. atroseptica SCRI1043	ECA1743	-274	7	TTGATTGAACGTTCAATAAA
Proteus mirabilis HI4320	PMI1462	-161	6.5	TTAATTGAACATTCAATCAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Propagation of BetI regulog to Escherichia coli O157:H7 str. EC4113

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --