Propagation of Rex regulog to Bacillus tusciae DSM 2912
| Source regulog: | Rex - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | Rex |
| Regulation mode: | repressor |
| Biological process: | Energy metabolism |
| Effector: | NADH |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus tusciae DSM 2912 |
| Orthologous TF(s) | Btus_1690 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -35
Score: 5.3 Sequence: TTTGTGAAATAAAACACAAA
Locus tag: Btus_1077
|
||||
| Btus_1077 | -35 | 5.3 | TTTGTGAAATAAAACACAAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: ndh | ||||
| Ortholog function: NADH dehydrogenase (EC 1.6.99.3) | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU12290 | -113 | 6 | ATTGTGCATGAATTCACAAT |
| Bacillus amyloliquefaciens FZB42 | RBAM_012370 | -110 | 6 | ATTGTGCATGAATTCACAAT |
| Bacillus licheniformis DSM 13 | BLi02134 | -80 | 6 | TTTGTGCATAAATTCACAAA |
| Bacillus cereus ATCC 14579 | BC5061 | -82 | 4.8 | TTTGTGAAACTTTGTATAAA |
| Paenibacillus sp. JDR-2 | Pjdr2_6269 | -97 | 5.4 | ATTGTGAATAATTTCACTTT |