Propagation of NikR regulog to Escherichia coli O157:H7 str. EC4113
| Source regulog: | NikR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | NikR |
| Regulation mode: | repressor |
| Biological process: | Nickel homeostasis |
| Effector: | Nickel ion, (Ni2+) |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Escherichia coli O157:H7 str. EC4113 |
| Orthologous TF(s) | EsccoliO157_010100000920 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -65
Score: 8 Sequence: GTATGACGAATACTTAAAATCGTCATAC
Locus tag: EsccoliO157_010100000950
|
||||
| EsccoliO157_010100000950 | -65 | 8 | GTATGACGAATACTTAAAATCGTCATAC | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: nikA | ||||
| Ortholog function: nickel ABC transporter, periplasmic nickel-binding protein | ||||
| Escherichia coli str. K-12 substr. MG1655 | b3476 | -65 | 8 | GTATGACGAATACTTAAAATCGTCATAC |
| Citrobacter koseri ATCC BAA-895 | CKO_04926 | -207 | 8 | GTATGATGAATCTTTAGAATCGTCATAC |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_03850 | -52 | 8 | GTATGATGAATCACTAAAATCGTCATAC |
| Enterobacter sp. 638 | Ent638_1834 | -64 | 7.9 | GTATGATGAATTATTAGAATCGTCACAC |
| Edwardsiella tarda EIB202 | ETAE_1379 | -59 | 7.7 | GTATGCAGAATTTATAAAATCATCATAC |