Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of Zur regulog to Escherichia coli O157:H7 str. EC4113

Reference regulog properties
Source regulog: Zur - Enterobacteriales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Escherichia coli O157:H7 str. EC4113
Orthologous TF(s) EsccoliO157_010100020720
Regulated genes 4
Built upon 65 sites [see more]
Predicted regulatory interactions in Escherichia coli O157:H7 str. EC4113
Locus tag Position Score Sequence
Position: -34
Score: 5.4
Sequence: TTGTGGTTATGTTATAACATAAC
Locus tag: EsccoliO157_010100012000
EsccoliO157_010100012000 -34 5.4 TTGTGGTTATGTTATAACATAAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: rpmE2
Ortholog function: 50S ribosomal protein L31 paralog
Escherichia coli str. K-12 substr. MG1655 b0296 -34 5.6 TTATGGTTATGTTATAACATAAC
Salmonella typhimurium LT2 STM0469 -35 5.8 TTATTGTTATGTTATAACATAAT
Citrobacter koseri ATCC BAA-895 CKO_02696 -35 5.5 TTATTGTTACGTTATAACATAAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00435 -35 5.5 TTATTGTTATGTTATAACGTAAT
Enterobacter sp. 638 Ent638_0934 -37 5.6 CTTTTGTTATGTTATAACAAAAC
Erwinia amylovora ATCC 49946 EAM_1015 -36 6 TTTTGGTTATATTATAACATATC
Yersinia pestis KIM y1048 -36 5.9 ATGATGTTACATTATAACATACT
Serratia proteamaculans 568 Spro_1125 -36 6.2 TTATTGTTATAGTATAACATTAC
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1168 -31 6 GATATGTTATAACATAACAATTG
Proteus mirabilis HI4320 PMI3379 -38 6.5 ATATTGTTATATTATAACATTAC
Photorhabdus luminescens subsp. laumondii TTO1 plu0036 -32 6.2 GTAATGTTATATTATTACAATTT
Position: -56
Score: 6.2
Sequence: CATATGTTACAATATAACATTAC
Locus tag: EsccoliO157_010100027963
EsccoliO157_010100027963 -56 6.2 CATATGTTACAATATAACATTAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: zinT
Ortholog function: zinc-binding protein
Escherichia coli str. K-12 substr. MG1655 b1973 -56 6.3 TATATGTTACAATATAACATTAC
Salmonella typhimurium LT2 STM1263 -54 6.2 GCAATGTTATAATATAACAATCA
Citrobacter koseri ATCC BAA-895 CKO_01827 -91 6.8 GTGATGTTATATTATAACATTCC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04244 -55 5.7 GATATGTTATATCGTAACAATTT
Enterobacter sp. 638 Ent638_1993 -53 6.1 GATATGTTATACTATAACATCCT
Proteus mirabilis HI4320 PMI3380 -38 6.5 ATATTGTTATATTATAACATTAC
Position: -53
Score: 6.3
Sequence: GGATTGTTATATTATAACAGTTC
Locus tag: EsccoliO157_010100031272
EsccoliO157_010100031272 -53 6.3 GGATTGTTATATTATAACAGTTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: pliG
Ortholog function: periplasmic lysozme inhibitor of g-type lysozyme
Escherichia coli str. K-12 substr. MG1655 b1178 -53 6.3 GGATTGTTATATTATAACAGTTC
Salmonella typhimurium LT2 STM2610 -54 5.9 TTATTGTTACAATATAACAATTA
© 2009-2020 RegPrecise