Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of LexA regulog to Escherichia coli O157:H7 str. EC4113

Reference regulog properties
Source regulog: LexA - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Escherichia coli O157:H7 str. EC4113
Orthologous TF(s) EsccoliO157_010100020735
Regulated genes 19
Built upon 265 sites [see more]
Predicted regulatory interactions in Escherichia coli O157:H7 str. EC4113
Locus tag Position Score Sequence
Position: -39
Score: 5.6
Sequence: ACCTGTATAAATAACCAGTA
Locus tag: EsccoliO157_010100001742
EsccoliO157_010100001742 -39 5.6 ACCTGTATAAATAACCAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: dinI
Ortholog function: DNA damage-inducible protein
Escherichia coli str. K-12 substr. MG1655 b1061 -39 5.6 ACCTGTATAAATAACCAGTA
Salmonella typhimurium LT2 STM1162 -39 6.1 AACTGTATATATATCCAGTA
Citrobacter koseri ATCC BAA-895 CKO_02002 -39 5.9 AACTGTATAAATACACAGTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01073 -39 5.9 TACTGTATAAATAACCAGTA
Enterobacter sp. 638 Ent638_1575 -39 5.8 GACTGTATAAATAAACAGTA
Erwinia amylovora ATCC 49946 EAM_1429 -38 5.8 AACTGTATATATTTACAGTT
Yersinia pestis KIM y1747 -41 6.1 TACTGTATAAATAAACAGTA
Serratia proteamaculans 568 Spro_1895 -39 6 AACTGTATAAATATCCAGTA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1786 -38 5.9 AACTGTATAAATAAACAGTT
Edwardsiella tarda EIB202 ETAE_2072 -42 5.7 AGCTGTATATATTTACAGTA
Position: -69
Score: 5
Sequence: CGCTGGATATCTATCCAGCA
Locus tag: EsccoliO157_010100005512
EsccoliO157_010100005512 -69 5 CGCTGGATATCTATCCAGCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ruvA
Ortholog function: Holliday junction helicase subunit A
Escherichia coli str. K-12 substr. MG1655 b1861 -69 5 CGCTGGATATCTATCCAGCA
Salmonella typhimurium LT2 STM1895 -71 4.8 ATCTGGATAAACATCCAGTC
Citrobacter koseri ATCC BAA-895 CKO_01099 -70 4.6 GGCTGGATATCTATCCAGCC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02376 -69 4.6 GGCTGGATATCTATCCAGCC
Enterobacter sp. 638 Ent638_2430 -69 4.6 GGCTGGATAAACATCCAGCC
Erwinia amylovora ATCC 49946 EAM_2004 -68 5 AGCTGGATATCTATCCAGCT
Yersinia pestis KIM y2253 -244 4.4 GGCTGGATATCCATCCAGCC
Serratia proteamaculans 568 Spro_2777 -91 4.6 GGCTGGATATTCATCCAGCC
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2492 -84 4.9 TGCTGGATATTCATCCAGCC
Edwardsiella tarda EIB202 ETAE_1439 -74 4.6 GGCTGGATATTCATCCAGCC
Proteus mirabilis HI4320 PMI1115 -68 4.5 GGCTGGATATACGTCCAGCT
Photorhabdus luminescens subsp. laumondii TTO1 plu2111 -85 4.6 GGCTGGATATGCATCCAGCT
Position: -171
Score: 5.5
Sequence: ACCTGAATGAATATACAGTA
Locus tag: EsccoliO157_010100006577
EsccoliO157_010100006577 -171 5.5 ACCTGAATGAATATACAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ssb
Ortholog function: single-strand binding protein
Escherichia coli str. K-12 substr. MG1655 b4059 -170 5.5 ACCTGAATGAATATACAGTA
Salmonella typhimurium LT2 STM4256 -167 5.7 ACCTGTTTGAATATACAGTA
Citrobacter koseri ATCC BAA-895 CKO_03842 -168 5.3 ACCTGAATGGATATACAGTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04446 -166 5.5 ACCTGAATGAATATACAGTA
Enterobacter sp. 638 Ent638_0262 -165 5.7 ACCTGTTTGAATATACAGTA
Erwinia amylovora ATCC 49946 EAM_0308 -171 4.5 GCCTGAATGGATAACCAGTG
Yersinia pestis KIM y0582 -158 4.8 ACCTGAATGGATATCCAGTG
Serratia proteamaculans 568 Spro_4439 -157 5.2 ACCTGAATGAATATCCAGTA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3690 -158 5.5 AACTGAATGAATATCCAGTA
Position: -103
Score: 5.5
Sequence: TACTGTATATTCATTCAGGT
Locus tag: EsccoliO157_010100006582
EsccoliO157_010100006582 -103 5.5 TACTGTATATTCATTCAGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: uvrA
Ortholog function: excinuclease ABC subunit A
Escherichia coli str. K-12 substr. MG1655 b4058 -103 5.5 TACTGTATATTCATTCAGGT
Salmonella typhimurium LT2 STM4254 -100 5.7 TACTGTATATTCAAACAGGT
Citrobacter koseri ATCC BAA-895 CKO_03843 -102 5.3 TACTGTATATCCATTCAGGT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04445 -105 5.5 TACTGTATATTCATTCAGGT
Enterobacter sp. 638 Ent638_0261 -100 5.7 TACTGTATATTCAAACAGGT
Erwinia amylovora ATCC 49946 EAM_0307 -101 4.5 CACTGGTTATCCATTCAGGC
Yersinia pestis KIM y0580 -318 4.8 CACTGGATATCCATTCAGGT
Serratia proteamaculans 568 Spro_4440 -140 5.2 TACTGGATATTCATTCAGGT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3689 -107 5.5 TACTGGATATTCATTCAGTT
Edwardsiella tarda EIB202 ETAE_3184 -92 5.3 TACTGGATATCCATTCAGTT
Proteus mirabilis HI4320 PMI2746 -84 5.3 TACTGTATATCCATTCAGCT
Photorhabdus luminescens subsp. laumondii TTO1 plu4350 -209 5.3 TACTGTATATCTAATCAGTC
Position: -63
Score: 5.9
Sequence: AACTGTATATAAATACAGTT
Locus tag: EsccoliO157_010100009663
EsccoliO157_010100009663 -63 5.9 AACTGTATATAAATACAGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: dinD
Ortholog function: DNA-damage-inducible protein
Escherichia coli str. K-12 substr. MG1655 b3645 -63 5.9 AACTGTATATAAATACAGTT
Position: -69
Score: 4.9
Sequence: TGCTGTTTTTATAAACAATG
Locus tag: EsccoliO157_010100013072
EsccoliO157_010100013072 -69 4.9 TGCTGTTTTTATAAACAATG
Supported by regulated orthologs from reference regulons
Ortholog gene name: mug
Ortholog function: DNA glycosylase, G/U mismatch specific
Escherichia coli str. K-12 substr. MG1655 b3068 -69 4.9 TGCTGTTTTTATAAACAATG
Salmonella typhimurium LT2 STM3212 -70 4.9 TGCTGTTTTTATAAACAATG
Citrobacter koseri ATCC BAA-895 CKO_04467 -70 4.7 TGCTGTTTTTATAAACAACG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03475 -69 4.9 TGCTGTTTTTATAAACAATG
Enterobacter sp. 638 Ent638_3474 -70 4.9 TGCTGTTTTTATAAACAATG
Position: -33
Score: 5.1
Sequence: CACTGGATAGATAACCAGCA
Locus tag: EsccoliO157_010100013573
EsccoliO157_010100013573 -33 5.1 CACTGGATAGATAACCAGCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: cho
Ortholog function: endonuclease of nucleotide excision repair
Escherichia coli str. K-12 substr. MG1655 b1741 -33 5.1 CACTGGATAGATAACCAGCA
Salmonella typhimurium LT2 STM1309 -6 5.5 TACTGGATGAATAACCAGTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01227 -32 5.3 TACTGGATGGATAGACAGTA
Position: -34
Score: 4.7
Sequence: TACTGTACGTATCGACAGTT
Locus tag: EsccoliO157_010100013643
EsccoliO157_010100013643 -34 4.7 TACTGTACGTATCGACAGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ydjM
Ortholog function: membrane-bound metal-dependent hydrolase
Escherichia coli str. K-12 substr. MG1655 b1728 -52 4.4 CACTGTATAAAAATCCTATA
-34 4.7 TACTGTACGTATCGACAGTT
Salmonella typhimurium LT2 STM1321 -52 4.4 TACTGTATAAAAACCCTATA
-34 5.2 TACTGTATGAATTGACAGTT
Citrobacter koseri ATCC BAA-895 CKO_01754 -52 4.4 TACTGTATAAAAACCCTATA
-34 5.2 TACTGTATGAATTGACAGTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01239 -34 5 TACTGTATGAATCGACAGTT
Enterobacter sp. 638 Ent638_1715 -34 5.2 TACTGTATGAATTGACAGTT
Erwinia amylovora ATCC 49946 EAM_1619 -56 4.3 TACTGTATATATTCCCTATA
-38 4.8 TACTGGATGCATTGACAGTT
Yersinia pestis KIM y1879 -39 5 TACTGGATAAATCAACAGCT
Serratia proteamaculans 568 Spro_2124 -39 5.4 TACTGGATAAATTAACAGTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2409 -36 5.4 TACTGTATAAAATAACAGTT
Edwardsiella tarda EIB202 ETAE_1569 -109 5.5 TTCTGTATATTTATACAGCA
Proteus mirabilis HI4320 PMI1020 -54 5.2 CACTGTATAAATGAACAGCA
Photorhabdus luminescens subsp. laumondii TTO1 plu2679 -37 5 GACTGTATGGATAGACAGTT
Position: -95
Score: 4.8
Sequence: TACTGATGATATATCCAGGT
Locus tag: EsccoliO157_010100013853
EsccoliO157_010100013853 -95 4.8 TACTGATGATATATCCAGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yjiW
Ortholog function: LexA regulated, putative SOS response
Escherichia coli str. K-12 substr. MG1655 b4347 -95 5 TACTGATGATATATACAGGT
Salmonella typhimurium LT2 STM4523 -94 4.4 TACTGATGTTATGTACAGGT
Position: -79
Score: 5.7
Sequence: TACTGTATGAGCATACAGTA
Locus tag: EsccoliO157_010100016382
EsccoliO157_010100016382 -79 5.7 TACTGTATGAGCATACAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: recA
Ortholog function: Recombinase A
Escherichia coli str. K-12 substr. MG1655 b2699 -79 5.7 TACTGTATGAGCATACAGTA
Salmonella typhimurium LT2 STM2829 -84 5.7 TACTGTATGAGCATACAGTA
Citrobacter koseri ATCC BAA-895 CKO_04050 -96 5.5 TACTGTATGACTGTACAGTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03031 -90 5.8 TACTGTATGACCATACAGTA
Enterobacter sp. 638 Ent638_3174 -92 5.9 TACTGTATGACTATACAGTA
Erwinia amylovora ATCC 49946 EAM_2640 -88 6.1 TACTGTATGATTATACAGTA
Yersinia pestis KIM y0881 -102 5.6 TACTGTATGATTGTACAGTA
Serratia proteamaculans 568 Spro_0841 -100 5.8 TACTGTATGACCATACAGTA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3369 -101 5.7 TGCTGTATGTGTATACAGTA
Edwardsiella tarda EIB202 ETAE_2861 -63 5.7 TACTGTATGAGCATACAGTA
Proteus mirabilis HI4320 PMI0375 -102 6.1 TACTGTATGATTATACAGTA
Photorhabdus luminescens subsp. laumondii TTO1 plu1249 -100 5.8 TGCTGTATGATTATACAGTA
Position: -34
Score: 5
Sequence: CACTGTATACTTTACCAGTA
Locus tag: EsccoliO157_010100017572
EsccoliO157_010100017572 -34 5 CACTGTATACTTTACCAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: dinB
Ortholog function: DNA polymerase IV (EC 2.7.7.7)
Escherichia coli str. K-12 substr. MG1655 b0231 -34 4.8 CACTGTATACTTTACCAGTG
Salmonella typhimurium LT2 STM0313 -35 5.4 TACTGTACACTTAAACAGTA
Citrobacter koseri ATCC BAA-895 CKO_02960 -35 5.8 TACTGTATACTTAAACAGTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00247 1 5.2 TGCTGTATGGGTATACAGTG
Enterobacter sp. 638 Ent638_0762 -37 5.8 TACTGTATACTTATCCAGTA
Erwinia amylovora ATCC 49946 EAM_0894 -36 5.4 GACTGTATACTTATCCAGTA
Yersinia pestis KIM y0959 -41 5.3 GACTGTATACTTATACAGCT
Serratia proteamaculans 568 Spro_0962 -35 5.7 GCCTGTATATTTATACAGTA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3468 -36 5.5 ATCTGTATATTCATACAGTA
Edwardsiella tarda EIB202 ETAE_0788 -42 5.6 TGCTGTATACTCATACAGTA
Proteus mirabilis HI4320 PMI0362 -39 6.1 TACTGTATATTTAAACAGTA
Photorhabdus luminescens subsp. laumondii TTO1 plu1239 -42 4.8 TTATGTATGTTTATACAGTT
Position: -76
Score: 4.9
Sequence: ATCTGTATATATACCCAGCT
Locus tag: EsccoliO157_010100018398
EsccoliO157_010100018398 -76 4.9 ATCTGTATATATACCCAGCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: uvrD
Ortholog function: ATP-dependent DNA helicase II
Escherichia coli str. K-12 substr. MG1655 b3813 -76 4.9 ATCTGTATATATACCCAGCT
Salmonella typhimurium LT2 STM3951 -125 4.8 TTCTGTATAAATTCCCAGTT
Citrobacter koseri ATCC BAA-895 CKO_00155 -76 5 TATTGTATATATACCCAGCT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04312 -53 4.6 CTCTGTATATATTAACAGGG
Enterobacter sp. 638 Ent638_3979 -68 5.1 TATTGTATAAATCAACAGTA
Erwinia amylovora ATCC 49946 EAM_0187 -55 5 ACCTGGTTATTTAACCAGTG
Yersinia pestis KIM y0389 -82 4.7 CCCTGTGTAAATCTACAGTG
Serratia proteamaculans 568 Spro_0186 -56 4.4 CTCTGTATAAATTCCCAGTG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA4179 -71 4.5 ATCTGTATAAATCACCAGTG
Edwardsiella tarda EIB202 ETAE_0126 -65 5 TTCTGTATAAATCTCCAGTA
Proteus mirabilis HI4320 PMI3340 -47 5.1 TTCTGTATATATCCACAGTA
Photorhabdus luminescens subsp. laumondii TTO1 plu4636 -55 5 TTCTGTATAAAAACACAGCA
Position: -47
Score: 5.1
Sequence: TGCTGTATATACTCACAGCA
Position: -26
Score: 5.2
Sequence: AACTGTATATACACCCAGGG
Locus tag: EsccoliO157_010100020735
EsccoliO157_010100020735 -47 5.1 TGCTGTATATACTCACAGCA
-26 5.2 AACTGTATATACACCCAGGG
Supported by regulated orthologs from reference regulons
Ortholog gene name: lexA
Ortholog function: SOS-response repressor and protease LexA (EC 3.4.21.88)
Escherichia coli str. K-12 substr. MG1655 b4043 -47 5.1 TGCTGTATATACTCACAGCA
-26 5.2 AACTGTATATACACCCAGGG
Salmonella typhimurium LT2 STM4237 -47 5.2 AACTGTATATACTCACAGCA
-26 4.4 GATTGTATATACACCCAGGG
Citrobacter koseri ATCC BAA-895 CKO_03872 -47 5 AGCTGTATATACTCACAGCA
-26 5.2 AACTGTATATACACCCAGGG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04431 -47 5 AGCTGTATATACTCACAGCA
-26 5.2 AACTGTATATACACCCAGGG
Enterobacter sp. 638 Ent638_0247 -47 5 GACTGTATATACTCACAGCA
-26 5.2 AACTGTATATACACCCAGGG
Erwinia amylovora ATCC 49946 EAM_0264 -46 4.9 ACCTGTATATACTCACAGTC
-26 5 GACTGTATAAACAACCAGGG
Yersinia pestis KIM y0572 -47 5 AGCTGTATATACTCACAGCA
-26 5.4 AACTGTATAAACAAACAGGG
Serratia proteamaculans 568 Spro_4460 -47 5 ACCTGTATATACTCACAGCA
-26 5.2 GACTGTATAAACAAACAGGG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0630 -47 5 ACCTGTATATACTCACAGCA
-26 5 GACTGTATAAACAACCAGGG
Edwardsiella tarda EIB202 ETAE_0230 -47 5 ACCTGTATATACTCACAGCA
-26 5 AACTGTATAAACGAACAGGG
Proteus mirabilis HI4320 PMI2749 -47 4.9 ACCTGTATATACTCACAGTC
-26 5.2 GACTGTATAAACAAACAGGG
Photorhabdus luminescens subsp. laumondii TTO1 plu4374 -26 5.2 GACTGTATAAACAAACAGGG
Position: -42
Score: 5.6
Sequence: TACTGTACATCCATACAGTA
Locus tag: EsccoliO157_010100023210
EsccoliO157_010100023210 -42 5.6 TACTGTACATCCATACAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: sulA
Ortholog function: Cell division inhibitor sulA
Escherichia coli str. K-12 substr. MG1655 b0958 -42 5.6 TACTGTACATCCATACAGTA
Salmonella typhimurium LT2 STM1071 -41 6.2 TACTGTATGAATATACAGTA
Citrobacter koseri ATCC BAA-895 CKO_02110 -41 6 TACTGTATATCCATACAGTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00987 -39 6 TACTGTATATGCATACAGTA
Enterobacter sp. 638 Ent638_1470 -34 6.2 TACTGTATATTCATACAGTA
Erwinia amylovora ATCC 49946 EAM_1378 -40 5.7 TACTGTATATCCATACAGTC
Yersinia pestis KIM y2734 -39 6.1 TACTGTATATACATACAGCA
Serratia proteamaculans 568 Spro_1755 -41 5.9 TACTGTATAAACATACAGTG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1752 -41 6.1 TACTGTATGTTCATACAGTA
Edwardsiella tarda EIB202 ETAE_1269 -115 5.9 TACTGTATAAGCATACAGTA
Proteus mirabilis HI4320 PMI0786 -39 6.3 TACTGTATATACATACAGTA
Photorhabdus luminescens subsp. laumondii TTO1 plu1776 -40 6 TACTGTATATTAATACAGTT
Position: -73
Score: 4.3
Sequence: GACTGTATAAAACCACAGCC
Locus tag: EsccoliO157_010100024006
EsccoliO157_010100024006 -73 4.3 GACTGTATAAAACCACAGCC
Supported by regulated orthologs from reference regulons
Ortholog gene name: polB
Ortholog function: DNA polymerase II (EC 2.7.7.7)
Escherichia coli str. K-12 substr. MG1655 b0060 -73 4.3 GACTGTATAAAACCACAGCC
Salmonella typhimurium LT2 STM0097 -73 4.6 gcCTGTAcAaAataACAGTA
Citrobacter koseri ATCC BAA-895 CKO_03322 -73 4.7 ACCTGTATAAAACCACAGCA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00059 -75 4.2 ACCTGTATAAAACCCCAGCG
Enterobacter sp. 638 Ent638_0607 30 4.6 ACCTGTATAAAATCCCAGCA
Erwinia amylovora ATCC 49946 EAM_0673 -53 4.9 TACTGTATAAATAAACATGC
Position: -34
Score: 6.1
Sequence: TACTGTATATAAAAACAGTA
Locus tag: EsccoliO157_010100024755
EsccoliO157_010100024755 -34 6.1 TACTGTATATAAAAACAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: sbmC
Ortholog function: DNA gyrase inhibitor
Escherichia coli str. K-12 substr. MG1655 b2009 -34 6.1 TACTGTATATAAAAACAGTA
Salmonella typhimurium LT2 STM2061 -41 5.5 TACTGTACATTCATACAGCA
Citrobacter koseri ATCC BAA-895 CKO_00775 -157 5.7 TGCTGTGTTTATATACAGTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02467 -42 5.8 AGCTGTATATTCATACAGTA
Enterobacter sp. 638 Ent638_2577 -35 5.3 TAGTGTATAAATACACAGTA
Position: -37
Score: 5.1
Sequence: TACTGTATAGAATCACAGTT
Locus tag: EsccoliO157_010100027493
EsccoliO157_010100027493 -37 5.1 TACTGTATAGAATCACAGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yebG
Ortholog function: SOS regulon DNA damage-inducible protein
Escherichia coli str. K-12 substr. MG1655 b1848 -37 5.3 TACTGTATAAAATCACAGTT
Salmonella typhimurium LT2 STM1882 -37 5.5 TACTGTATATAAACACAGGT
Citrobacter koseri ATCC BAA-895 CKO_01118 -38 4.8 TGCTGTACATAATTACAGGT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02363 -35 5.9 TACTGTATAAAAATACAGTG
Enterobacter sp. 638 Ent638_1887 -33 5.3 CACTGTATATAATTACAGTG
Erwinia amylovora ATCC 49946 EAM_1993 -35 5.7 TACTGTATAAAAACACAGTT
Yersinia pestis KIM y2530 -47 5.2 CACTGTGATTATATACAGTT
Serratia proteamaculans 568 Spro_2803 -44 6.1 TACTGTATAAAAATACAGTA
Edwardsiella tarda EIB202 ETAE_1833 -31 5.8 TACTGTATATAAAAACAGTG
Position: -96
Score: 5
Sequence: TCCTGTTAATCCATACAGCA
Locus tag: EsccoliO157_010100027633
EsccoliO157_010100027633 -96 5 TCCTGTTAATCCATACAGCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ftsK
Ortholog function: DNA translocase FtsK
Escherichia coli str. K-12 substr. MG1655 b0890 -96 5 TCCTGTTAATCCATACAGCA
Salmonella typhimurium LT2 STM0960 -96 5 TCCTGTTAATCCATACAGCA
Citrobacter koseri ATCC BAA-895 CKO_02181 -39 5 TCCTGTTAATCCATACAGCA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00922 -97 5 TCCTGTTAATCCATACAGCA
Enterobacter sp. 638 Ent638_1414 -96 5 TCCTGTTAATCCATACAGCA
Erwinia amylovora ATCC 49946 EAM_1329 -80 4.9 TCCTGTGAATTCATACAGGT
Yersinia pestis KIM y2800 -86 5.7 TCCTGTTTATTCATACAGTT
Serratia proteamaculans 568 Spro_1683 -85 5.7 TCCTGTTTATTCATACAGTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2647 -78 5 TCCTGTGAATTTATACAGTC
Edwardsiella tarda EIB202 ETAE_2199 -114 5.4 TCCTGTGTATGTATACAGTT
Proteus mirabilis HI4320 PMI0697 -83 5.6 TCCTGTTTATGTATACAGTT
Photorhabdus luminescens subsp. laumondii TTO1 plu1601 -81 5.5 TCCTGTTTATGCATACAGTT
Position: -39
Score: 6.1
Sequence: TACTGTATATAAAAACAGTA
Locus tag: EsccoliO157_010100031033
EsccoliO157_010100031033 -39 6.1 TACTGTATATAAAAACAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: umuD
Ortholog function: DNA polymerase V, subunit UmuD
Escherichia coli str. K-12 substr. MG1655 b1183 -39 6.1 TACTGTATATAAAAACAGTA
Salmonella typhimurium LT2 STM1998 -35 6.1 TACTGTATATAAAAACAGTA
Citrobacter koseri ATCC BAA-895 CKO_01842 -38 5.9 TACTGTATATATAATCAGTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01438 -40 5.8 TACTGTATATAAAAACAGTG
Enterobacter sp. 638 Ent638_2213 -34 5.9 TACTGTATGTAAAAACAGTA