Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of NagC regulog to Escherichia coli O157:H7 str. EC4113

Reference regulog properties
Source regulog: NagC - Enterobacteriales
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor (activator)
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine-6-phosphate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Escherichia coli O157:H7 str. EC4113
Orthologous TF(s) EsccoliO157_010100030363
Regulated genes 4
Built upon 68 sites [see more]
Predicted regulatory interactions in Escherichia coli O157:H7 str. EC4113
Locus tag Position Score Sequence
Position: -39
Score: 5.2
Sequence: CTTAATTCACAATAAAAAATAAC
Locus tag: EsccoliO157_010100003826
EsccoliO157_010100003826 -39 5.2 CTTAATTCACAATAAAAAATAAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: galP
Ortholog function: D-galactose transporter
Escherichia coli str. K-12 substr. MG1655 b2943 -39 5.2 CTTAATTCACAATAAAAAATAAC
Salmonella typhimurium LT2 STM3091 -139 4.7 TATTTTTCAGATAATTAAATAAT
Position: -233
Score: 4.8
Sequence: GTTTATTCATTGATCGAAATAAG
Locus tag: EsccoliO157_010100008828
EsccoliO157_010100008828 -233 4.8 GTTTATTCATTGATCGAAATAAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: glmU
Ortholog function: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
Escherichia coli str. K-12 substr. MG1655 b3730 -233 4.8 GTTTATTCATTGATCGAAATAAG
Salmonella typhimurium LT2 STM3862 -233 4.8 CTTTATTTATGGAGTAAAAAAAC
Citrobacter koseri ATCC BAA-895 CKO_00067 -233 4.8 CTTTATTCATGGGTCAAAAAAAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04135 -248 4.7 CTTTATTCAGGTGGCGAAAAAAC
Enterobacter sp. 638 Ent638_4135 -233 5.2 CTTTATTCATGAGGCGAAAAAAT
Yersinia pestis KIM y4133 -235 4.8 CTTGTTTTCTGTCGTAAAATAAG
Serratia proteamaculans 568 Spro_0010 -242 5 CTTTTTTTTTGTTTTAAAATAAG
Proteus mirabilis HI4320 PMI3066 -84 5.3 AATATTTTGTGTAACGAAATATG
Photorhabdus luminescens subsp. laumondii TTO1 plu0038 -85 4.7 GCTTTTTTGTATTGCGAAATATG
Position: -140
Score: 5.2
Sequence: ATTTTTTCGATATCTAAAATAAA
Locus tag: EsccoliO157_010100013113
EsccoliO157_010100013113 -140 5.2 ATTTTTTCGATATCTAAAATAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: manX
Ortholog function: PTS system, mannose-specific IIAB component
Escherichia coli str. K-12 substr. MG1655 b1817 -140 5.2 ATTTTTTCGATATCTAAAATAAA
Position: -230
Score: 5.1
Sequence: CTTAATTATCTTCGCGAATTATT
Locus tag: EsccoliO157_010100013588
EsccoliO157_010100013588 -230 5.1 CTTAATTATCTTCGCGAATTATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: chbB
Ortholog function: PTS system, chitobiose-specific IIB component (EC 2.7.1.69)
Escherichia coli str. K-12 substr. MG1655 b1738 -230 5.1 CTTAATTATCTTCGCGAATTATT
Citrobacter koseri ATCC BAA-895 CKO_01763 -217 5.1 CTTATTTATTGTCGCGAAATATT
Enterobacter sp. 638 Ent638_1706 -197 4.9 CTTATTTATTTGCGCGAATTATT