Orthologous regulated operons containing chbB gene

Properties
Regulog:	NagC - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor (activator)
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine-6-phosphate
Phylum:	Proteobacteria/gamma

Built upon 68 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -217 Score: 5.14335 Sequence: CTTATTTATTGTCGCGAAATATT Locus tag: CKO_01763 Name: chbB Funciton: PTS system, chitobiose-specific IIB component (EC 2.7.1.69) Locus tag: CKO_01762 Name: chbC Funciton: PTS system, chitobiose-specific IIC component (EC 2.7.1.69) Locus tag: CKO_01761 Name: chbA Funciton: N,N'-diacetylchitobiose-specific PTS system, EIIA component Locus tag: CKO_01760 Name: chbR Funciton: Chitobiose-specific regulator ChbR, AraC family Locus tag: CKO_01759 Name: chbF Funciton: Chitobiose-specific 6-phospho-beta-glucosidase ChbF (EC 3.2.1.86) Locus tag: CKO_01758 Name: chbG Funciton: Cellobiose phosphotransferase system YdjC-like protein
chbB-chbC-chbA-chbR-chbF-chbG	-217	5.1	CTTATTTATTGTCGCGAAATATT	CKO_01763
Enterobacter sp. 638
Position: -197 Score: 4.93151 Sequence: CTTATTTATTTGCGCGAATTATT Locus tag: Ent638_1706 Name: chbB Funciton: PTS system, chitobiose-specific IIB component (EC 2.7.1.69) Locus tag: Ent638_1707 Name: chbC Funciton: PTS system, chitobiose-specific IIC component (EC 2.7.1.69) Locus tag: Ent638_1708 Name: chbA Funciton: N,N'-diacetylchitobiose-specific PTS system, EIIA component Locus tag: Ent638_1709 Name: chbR Funciton: Chitobiose-specific regulator ChbR, AraC family Locus tag: Ent638_1710 Name: chbF Funciton: Chitobiose-specific 6-phospho-beta-glucosidase ChbF (EC 3.2.1.86) Locus tag: Ent638_1711 Name: chbG Funciton: Cellobiose phosphotransferase system YdjC-like protein
chbB-chbC-chbA-chbR-chbF-chbG	-197	4.9	CTTATTTATTTGCGCGAATTATT	Ent638_1706
Escherichia coli str. K-12 substr. MG1655
Position: -230 Score: 5.11496 Sequence: CTTAATTATCTTCGCGAATTATT Locus tag: b1738 Name: chbB Funciton: PTS system, chitobiose-specific IIB component (EC 2.7.1.69) Locus tag: b1737 Name: chbC Funciton: PTS system, chitobiose-specific IIC component (EC 2.7.1.69) Locus tag: b1736 Name: chbA Funciton: N,N'-diacetylchitobiose-specific PTS system, EIIA component Locus tag: b1735 Name: chbR Funciton: Chitobiose-specific regulator ChbR, AraC family Locus tag: b1734 Name: chbF Funciton: Chitobiose-specific 6-phospho-beta-glucosidase ChbF (EC 3.2.1.86) Locus tag: b1733 Name: chbG Funciton: Cellobiose phosphotransferase system YdjC-like protein
chbB-chbC-chbA-chbR-chbF-chbG	-230	5.1	CTTAATTATCTTCGCGAATTATT	b1738
Proteus mirabilis HI4320
Position: -255 Score: 4.75682 Sequence: CAAATTTTGTAACGCGAAACAAT Locus tag: PMI2956 Name: chbB Funciton: PTS system, chitobiose-specific IIB component (EC 2.7.1.69) Locus tag: PMI2955 Name: chbC Funciton: PTS system, chitobiose-specific IIC component (EC 2.7.1.69) Locus tag: PMI2954 Name: chbA Funciton: N,N'-diacetylchitobiose-specific PTS system, EIIA component Locus tag: PMI2953 Name: chbR Funciton: Chitobiose-specific regulator ChbR, AraC family Locus tag: PMI2952 Name: chbF Funciton: Chitobiose-specific 6-phospho-beta-glucosidase ChbF (EC 3.2.1.86) Locus tag: PMI2951 Name: chbG Funciton: Cellobiose phosphotransferase system YdjC-like protein
chbB-chbC-chbA-chbR-chbF-chbG	-255	4.8	CAAATTTTGTAACGCGAAACAAT	PMI2956
Salmonella typhimurium LT2
Position: -232 Score: 5.10939 Sequence: CTTATTTATTATCGCGAATTATT Locus tag: STM1312 Name: chbB Funciton: PTS system, chitobiose-specific IIB component (EC 2.7.1.69) Locus tag: STM1313 Name: chbC Funciton: PTS system, chitobiose-specific IIC component (EC 2.7.1.69) Locus tag: STM1314 Name: chbA Funciton: N,N'-diacetylchitobiose-specific PTS system, EIIA component Locus tag: STM1315 Name: chbR Funciton: Chitobiose-specific regulator ChbR, AraC family Locus tag: STM1316 Name: chbF Funciton: Chitobiose-specific 6-phospho-beta-glucosidase ChbF (EC 3.2.1.86) Locus tag: STM1317 Name: chbG Funciton: Cellobiose phosphotransferase system YdjC-like protein
chbB-chbC-chbA-chbR-chbF-chbG	-232	5.1	CTTATTTATTATCGCGAATTATT	STM1312
Yersinia pestis KIM
Position: -242 Score: 4.98718 Sequence: CTTATTTCGTCAAGAAAAAAATT Locus tag: y1251 Name: chbB Funciton: PTS system, chitobiose-specific IIB component (EC 2.7.1.69) Locus tag: y1252 Name: chbC Funciton: PTS system, chitobiose-specific IIC component (EC 2.7.1.69) Locus tag: y1253 Name: chbA Funciton: N,N'-diacetylchitobiose-specific PTS system, EIIA component Locus tag: y1254 Name: chbR Funciton: Chitobiose-specific regulator ChbR, AraC family Locus tag: y1255 Name: chbG Funciton: Cellobiose phosphotransferase system YdjC-like protein
chbB-chbC-chbA-chbR-chbG	-242	5	CTTATTTCGTCAAGAAAAAAATT	y1251