Propagation of TreR regulog to Escherichia coli O157:H7 str. EC4196
Source regulog: | TreR - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Trehalose utilization |
Effector: | Trehalose-6-phosphate |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Escherichia coli O157:H7 str. EC4196 |
Orthologous TF(s) | EschcoliO157_010100009394 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -82
Score: 6.8 Sequence: TTTCGGGAACGTTCCCGTTT
Locus tag: ECH7EC4196_1084
|
||||
ECH7EC4196_1084 | -82 | 6.8 | TTTCGGGAACGTTCCCGTTT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: treB | ||||
Ortholog function: PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69) | ||||
Escherichia coli str. K-12 substr. MG1655 | b4240 | -82 | 6.8 | TTTCGGGAACGTTCCCGTTT |
Citrobacter koseri ATCC BAA-895 | CKO_03571 | -137 | 7.1 | TTTCGGGAACGTTCCCATTT |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04652 | -97 | 7.1 | TTTCGGGAACGTTCCCATTT |
Enterobacter sp. 638 | Ent638_0439 | -87 | 7.1 | TTTCGGGAACGTTCCCATTT |
Yersinia pestis KIM | y0166 | -321 | 6.6 | AAATGGGAACGTTCCCATTC |
Serratia proteamaculans 568 | Spro_0529 | -105 | 6.5 | AACCGGGAACGTTCCCATTC |
Proteus mirabilis HI4320 | PMI0291 | -78 | 6.8 | TTATGGGAACGTTCCCATTG |
Photorhabdus luminescens subsp. laumondii TTO1 | plu3288 | -107 | 6.6 | TTTTGGGAACGTTCCCATGA |