Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of TreR regulog to Escherichia coli O157:H7 str. EC4115

Reference regulog properties
Source regulog: TreR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Trehalose utilization
Effector: Trehalose-6-phosphate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Escherichia coli O157:H7 str. EC4115
Orthologous TF(s) ECH74115_5763
Regulated genes 1
Built upon 8 sites [see more]
Predicted regulatory interactions in Escherichia coli O157:H7 str. EC4115
Locus tag Position Score Sequence
Position: -82
Score: 6.8
Sequence: TTTCGGGAACGTTCCCGTTT
Locus tag: ECH74115_5762
ECH74115_5762 -82 6.8 TTTCGGGAACGTTCCCGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: treB
Ortholog function: PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69)
Escherichia coli str. K-12 substr. MG1655 b4240 -82 6.8 TTTCGGGAACGTTCCCGTTT
Citrobacter koseri ATCC BAA-895 CKO_03571 -137 7.1 TTTCGGGAACGTTCCCATTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04652 -97 7.1 TTTCGGGAACGTTCCCATTT
Enterobacter sp. 638 Ent638_0439 -87 7.1 TTTCGGGAACGTTCCCATTT
Yersinia pestis KIM y0166 -321 6.6 AAATGGGAACGTTCCCATTC
Serratia proteamaculans 568 Spro_0529 -105 6.5 AACCGGGAACGTTCCCATTC
Proteus mirabilis HI4320 PMI0291 -78 6.8 TTATGGGAACGTTCCCATTG
Photorhabdus luminescens subsp. laumondii TTO1 plu3288 -107 6.6 TTTTGGGAACGTTCCCATGA
© 2009-2020 RegPrecise