Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of CueR regulog to Shigella flexneri 2a str. 2457T

Reference regulog properties
Source regulog: CueR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shigella flexneri 2a str. 2457T
Orthologous TF(s) S0439
Regulated genes 1
Built upon 30 sites [see more]
Predicted regulatory interactions in Shigella flexneri 2a str. 2457T
Locus tag Position Score Sequence
Position: -67
Score: 6.6
Sequence: ACCTTCCCCTTGCTGGAAGGT
Locus tag: S0436
S0436 -67 6.6 ACCTTCCCCTTGCTGGAAGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: copA
Ortholog function: Copper-translocating P-type ATPase (EC 3.6.3.4)
Escherichia coli str. K-12 substr. MG1655 b0484 -67 6.6 ACCTTCCCCTTGCTGGAAGGT
© 2009-2020 RegPrecise