Propagation of YiaJ regulog to Shigella flexneri 2a str. 2457T
| Source regulog: | YiaJ - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | IclR |
| Regulation mode: | repressor |
| Biological process: | L-lyxose utilization |
| Effector: | Ascorbate-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Shigella flexneri 2a str. 2457T |
| Orthologous TF(s) | S4151 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -69
Score: 6.2 Sequence: ATTTGAAATCTAGTTCCGCAT
Locus tag: S4150
|
||||
| S4150 | -69 | 6.2 | ATTTGAAATCTAGTTCCGCAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: yiaK | ||||
| Ortholog function: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent | ||||
| Escherichia coli str. K-12 substr. MG1655 | b3575 | -70 | 6.4 | ATTTGAAATCAAGTTTCGCAT |
| Salmonella typhimurium LT2 | STM3668 | -82 | 6 | ATTTGGAACTAGATTTCGCAT |
| Citrobacter koseri ATCC BAA-895 | CKO_05033 | -72 | 6.5 | ATTTGAAATCAGATTTCGCAT |
| Serratia proteamaculans 568 | Spro_3933 | -74 | 6.1 | ATTTGAAATGCAATTCCGCAT |