Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of YiaJ regulog to Shigella flexneri 2a str. 301

Reference regulog properties
Source regulog: YiaJ - Enterobacteriales
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor
Biological process: L-lyxose utilization
Effector: Ascorbate-6-phosphate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shigella flexneri 2a str. 301
Orthologous TF(s) SF3618
Regulated genes 2
Built upon 8 sites [see more]
Predicted regulatory interactions in Shigella flexneri 2a str. 301
Locus tag Position Score Sequence
Position: -69
Score: 6.2
Sequence: ATTTGAAATCTAGTTCCGCAT
Locus tag: SF3619
SF3619 -69 6.2 ATTTGAAATCTAGTTCCGCAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yiaK
Ortholog function: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
Escherichia coli str. K-12 substr. MG1655 b3575 -70 6.4 ATTTGAAATCAAGTTTCGCAT
Salmonella typhimurium LT2 STM3668 -82 6 ATTTGGAACTAGATTTCGCAT
Citrobacter koseri ATCC BAA-895 CKO_05033 -72 6.5 ATTTGAAATCAGATTTCGCAT
Serratia proteamaculans 568 Spro_3933 -74 6.1 ATTTGAAATGCAATTCCGCAT