Propagation of QorR regulog to Yersinia enterocolitica subsp. enterocolitica 8081
| Source regulog: | QorR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | HxlR |
| Regulation mode: | repressor |
| Biological process: | Energy metabolism |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Yersinia enterocolitica subsp. enterocolitica 8081 |
| Orthologous TF(s) | YE1739 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -248
Score: 6.5 Sequence: GTACTTACTTAAAGTTAGTAT
Locus tag: YE1738
|
||||
| YE1738 | -248 | 6.5 | GTACTTACTTAAAGTTAGTAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: qorB | ||||
| Ortholog function: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) | ||||
| Citrobacter koseri ATCC BAA-895 | CKO_03618 | -34 | 6.6 | GTACTTACTAAAAGTAAGTTT |
| Enterobacter sp. 638 | Ent638_0383 | -67 | 6.3 | GTACTTACTATAAGTTAGTTA |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA4449 | -81 | 6.1 | GTACTTACTTAAAGTTAGCTT |
| Escherichia coli str. K-12 substr. MG1655 | b4211 | -67 | 6.6 | GTACTTACTAAAAGTAAGTTT |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04605 | -68 | 6.3 | GTACTTACTAAAAGTTAGTTA |
| Proteus mirabilis HI4320 | PMI0976 | -68 | 6.6 | GTACTTACTTTTAGTAAGTTT |
| Salmonella typhimurium LT2 | STM4401 | -67 | 6.6 | GTACTTACTAAAAGTAAGTTT |
| Yersinia pestis KIM | y1806 | -119 | 5.9 | GTACTTACGTAAAGTGAGTAT |
|
Position: -106
Score: 6.5 Sequence: ATACTAACTTTAAGTAAGTAC
Locus tag: YE1739
|
||||
| YE1739 | -106 | 6.5 | ATACTAACTTTAAGTAAGTAC | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: qorR | ||||
| Ortholog function: Redox-sensing transcriptional regulator QorR, HxlR family | ||||
| Citrobacter koseri ATCC BAA-895 | CKO_03617 | -43 | 6.6 | AAACTTACTTTTAGTAAGTAC |
| Enterobacter sp. 638 | Ent638_0384 | -37 | 6.3 | TAACTAACTTATAGTAAGTAC |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA4450 | -40 | 6.1 | AAGCTAACTTTAAGTAAGTAC |
| Escherichia coli str. K-12 substr. MG1655 | b4212 | -42 | 6.6 | AAACTTACTTTTAGTAAGTAC |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04606 | -42 | 6.3 | TAACTAACTTTTAGTAAGTAC |
| Proteus mirabilis HI4320 | PMI0975 | -42 | 6.6 | AAACTTACTAAAAGTAAGTAC |
| Salmonella typhimurium LT2 | STM4402 | -41 | 6.6 | AAACTTACTTTTAGTAAGTAC |