Propagation of TrpR regulog to Yersinia enterocolitica subsp. enterocolitica 8081
| Source regulog: | TrpR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | TrpR |
| Regulation mode: | repressor |
| Biological process: | Tryptophan biosynthesis |
| Effector: | Tryptophan |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Yersinia enterocolitica subsp. enterocolitica 8081 |
| Orthologous TF(s) | YE0590 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -35
Score: 6.2 Sequence: TGTACTAGTTAAATAGTATG
Locus tag: YE0590
|
||||
| YE0590 | -35 | 6.2 | TGTACTAGTTAAATAGTATG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: trpR | ||||
| Ortholog function: Trp operon repressor | ||||
| Escherichia coli str. K-12 substr. MG1655 | b4393 | -66 | 5.3 | CGTACTCTTTAGCGAGTACA |
| Salmonella typhimurium LT2 | STM4583 | -34 | 5.6 | TGTACTCGTGTAACAGTACA |
| Citrobacter koseri ATCC BAA-895 | CKO_03393 | -97 | 6 | CGTACTCGTTAAAGAGTACA |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04848 | -65 | 5.7 | TGTACTCGTTGAAGAGTACA |
| Enterobacter sp. 638 | Ent638_0554 | 3 | 5.5 | TGTACTcGTcAAagAGTACA |
| Erwinia amylovora ATCC 49946 | EAM_0634 | -33 | 6.2 | TGTACTAGTTAAATAGTATG |
| Yersinia pestis KIM | y3726 | -24 | 6.1 | TGTACTAGTTAAATAGTACT |
| Serratia proteamaculans 568 | Spro_0676 | -30 | 6.2 | TGTACTAGTTAAATAGTATG |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA3899 | -30 | 6.2 | CGTACTAGTTAAATAGTATG |
| Edwardsiella tarda EIB202 | ETAE_0543 | -44 | 5.6 | TGTACTCGTTGAATAGTTCA |
| Proteus mirabilis HI4320 | PMI3714 | -39 | 5.2 | TGTACTAGTTTATGAGTGTG |
| Photorhabdus luminescens subsp. laumondii TTO1 | plu0557 | -34 | 6.2 | TGTACTAGTTAAATAGTATG |
|
Position: -72
Score: 4.7 Sequence: CGTATCATTGAGCTAGTACA
Locus tag: YE1442
|
||||
| YE1442 | -72 | 4.7 | CGTATCATTGAGCTAGTACA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: mtr | ||||
| Ortholog function: Tryptophan-specific transport protein | ||||
| Yersinia pestis KIM | y2900 | -139 | 5 | TGTACCATTCAGCTAGTACA |
| Serratia proteamaculans 568 | Spro_3236 | -58 | 5.3 | TGTACCATTGAGCTAGTACA |
| Edwardsiella tarda EIB202 | ETAE_2287 | -48 | 4.8 | CGTACCATTGCGCTAGTACA |