Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SdaR regulog to Escherichia coli O157:H7 str. EC4042

Reference regulog properties
Source regulog: SdaR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: SdaR
Regulation mode: activator
Biological process: Glucarate utilization; Galactarate utilization
Effector: Glycerate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Escherichia coli O157:H7 str. EC4042
Orthologous TF(s) EschercoliO157_010100009188
Regulated genes 2
Built upon 31 sites [see more]
Predicted regulatory interactions in Escherichia coli O157:H7 str. EC4042
Locus tag Position Score Sequence
Position: -186
Score: 6
Sequence: TTATGTGCATATGCTCAAAA
Locus tag: EschercoliO157_010100003740
EschercoliO157_010100003740 -186 6 TTATGTGCATATGCTCAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: garP
Ortholog function: D-galactarate permease, MFS family
Escherichia coli str. K-12 substr. MG1655 b3127 -186 6 TTATGTGCATATGCTCAAAA
-144 4.5 AAATTAGCATTTGCACAATG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03539 -206 4.7 CTTATGGCATAAGCACAATT
Enterobacter sp. 638 Ent638_3569 -208 5.4 GGTTGTGCATATGCTCAAAT
Position: -69
Score: 5.3
Sequence: CTTTAGGCATTTGCACAATG
Locus tag: EschercoliO157_010100009188
EschercoliO157_010100009188 -69 5.3 CTTTAGGCATTTGCACAATG
Supported by regulated orthologs from reference regulons
Ortholog gene name: sdaR
Ortholog function: Glycerate-responsive transcriptional regulator for hexarate utilization, SdaR family
Escherichia coli str. K-12 substr. MG1655 b0162 -69 5.3 CTTTAGGCATTTGCACAATG
Salmonella typhimurium LT2 STM0210 -71 5.8 TTTTGTGCATTTGCACAATG
Citrobacter koseri ATCC BAA-895 CKO_03205 -17 5.1 GTTTGTGCAGATGCACAATG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00177 -17 5.4 CTTAGTGCAAATGCACAATG
Enterobacter sp. 638 Ent638_0702 -71 5.3 CTTTGTGCATTCGCACAATG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3300 -80 4.3 CTTTGTTAATTTGCACAATG