Propagation of NagC regulog to Escherichia coli O157:H7 str. EC4042

Reference regulog properties
Source regulog:	NagC - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor (activator)
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine-6-phosphate
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Escherichia coli O157:H7 str. EC4042
Orthologous TF(s)	EschercoliO157_010100031721
Regulated genes	3

Built upon 68 sites [see more]

Predicted regulatory interactions in *Escherichia coli O157:H7 str. EC4042*
	Locus tag	Position	Score	Sequence
Position: -39 Score: 5.2 Sequence: CTTAATTCACAATAAAAAATAAC Locus tag: EschercoliO157_010100004820
	EschercoliO157_010100004820	-39	5.2	CTTAATTCACAATAAAAAATAAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: galP
Ortholog function: D-galactose transporter
Escherichia coli str. K-12 substr. MG1655	b2943	-39	5.2	CTTAATTCACAATAAAAAATAAC
Salmonella typhimurium LT2	STM3091	-139	4.7	TATTTTTCAGATAATTAAATAAT

Position: -140 Score: 5.2 Sequence: ATTTTTTCGATATCTAAAATAAA Locus tag: EschercoliO157_010100012288
	EschercoliO157_010100012288	-140	5.2	ATTTTTTCGATATCTAAAATAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: manX
Ortholog function: PTS system, mannose-specific IIAB component
Escherichia coli str. K-12 substr. MG1655	b1817	-140	5.2	ATTTTTTCGATATCTAAAATAAA

Position: -230 Score: 5.1 Sequence: CTTAATTATCTTCGCGAATTATT Locus tag: EschercoliO157_010100012793
	EschercoliO157_010100012793	-230	5.1	CTTAATTATCTTCGCGAATTATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: chbB
Ortholog function: PTS system, chitobiose-specific IIB component (EC 2.7.1.69)
Escherichia coli str. K-12 substr. MG1655	b1738	-230	5.1	CTTAATTATCTTCGCGAATTATT
Citrobacter koseri ATCC BAA-895	CKO_01763	-217	5.1	CTTATTTATTGTCGCGAAATATT
Enterobacter sp. 638	Ent638_1706	-197	4.9	CTTATTTATTTGCGCGAATTATT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --