Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of RutR regulog to Escherichia coli F11

Reference regulog properties
Source regulog: RutR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Escherichia coli F11
Orthologous TF(s) EcolF_01002338
Regulated genes 3
Built upon 13 sites [see more]
Predicted regulatory interactions in Escherichia coli F11
Locus tag Position Score Sequence
Position: -125
Score: 6.2
Sequence: TTTTGACCGTTTAGTCCACT
Locus tag: EcolF_01002337
EcolF_01002337 -125 6.2 TTTTGACCGTTTAGTCCACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: rutA
Ortholog function: Pyrimidine oxygenase
Escherichia coli str. K-12 substr. MG1655 b1012 -126 6.2 TTTTGACCGTTTAGTCCACT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01038 -181 6 TTTTGACCATCCAGTCCACT
Enterobacter sp. 638 Ent638_1525 -185 6.1 TTTTGACCATTCAGTCCACT
Serratia proteamaculans 568 Spro_1823 -187 5.8 TTTTGACCAAATGGTCTGTT
Position: -124
Score: 4.3
Sequence: AGTGGACTAAACGGTCAAAA
Locus tag: EcolF_01002338
EcolF_01002338 -124 4.3 AGTGGACTAAACGGTCAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: rutR
Ortholog function: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
Escherichia coli str. K-12 substr. MG1655 b1013 -124 4.3 AGTGGACTAAACGGTCAAAA
Position: -267
Score: 6.5
Sequence: TTTTGACCATTTGGTCCACT
Locus tag: EcolF_01003978
EcolF_01003978 -267 6.5 TTTTGACCATTTGGTCCACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: carA
Ortholog function: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5)
Escherichia coli str. K-12 substr. MG1655 b0032 -294 6.5 TTTTGACCATTTGGTCCACT
Salmonella typhimurium LT2 STM0066 -294 6.5 ATTTGACCATTTGGTCCACT
Citrobacter koseri ATCC BAA-895 CKO_03351 -268 6.4 TTTTGACCAAATGGTCCACT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00040 -267 6.4 TTTTGACCATCTGGTCCACT
Enterobacter sp. 638 Ent638_0591 -294 5.8 TTTTGACCATTTGGTCTGGT
Erwinia amylovora ATCC 49946 EAM_0660 -297 6.2 TTCTGACCATTTGGTCCACT